Craig's Cynical Quotations Page

Cynical (i.e., accurate) quotations about technology, politics, religion, and life. Citations are provided where available. I should point out that I am neither a liberal nor a conservative; I am a centrist and a pragmatist.

My god can beat up your god. Do you know his name? Sure you do. He talks to you every day. You could not live a normal life without him. You believe in him, whether you like it or not. Unless you abandon him completely, you cannot deny he exists. (continued)

— Richard Bamford (2001-08-31) @ Secular Web

Here's the thing. America is a long-term plan for me. I don't know where these people plan to be in 10 years, but I plan to be here. This is, of course, the same argument heard around President Clinton's veto of ANWR [Arctic National Wildlife Refuge] drilling in 1995. Among other things, if we had started drilling ANWR then, oil would be already flowing. At its peak, ANWR could supply 1.45 million barrels per day, enough to tell Hugo Chavez and all his Venezuelan oil to shove it (with a little change left over).

— Glenn Beck @ CNN

It is a certain fact that not all Muslims are terrorists, but it is equally certain, and exceptionally painful, that almost all terrorists are Muslims. We cannot clear our names unless we own up to the shameful fact that terrorism has become an Islamic enterprise; an almost exclusive monopoly, implemented by Muslim men and women.

— Abdel Rahman al-Rashed @ BBC

The same people in the west who oppose(d) Somalia, Afghanistan, Iraq are the same ones who say why did we fail in Rwanda, Zimbabwe, Burma? We fail because the anti-war, politically correct world movement is incapable of finding solutions, just pointing out failures. They see actions as oil lust, hidden agendas, imperialism, etc. and inaction as racism, hidden agendas and double standards. When you base your entire political belief on thinking everything the US and Bush does is wrong, you miss the point on really understanding things. They made mistakes, no doubt about it, but to think the intent was malicious, oil lust with a disregard for human life is just lazy. Thinkers and doers need to take back politics and marginalize the anti-everything west movement that spun out of the 90's.

— Socrates21stC (2008-06-25) @ CBC

If you're looking for a wife, get out of the US. Our angry, second-wave-feminist, crybaby boomer mothers raised our generation for men to hate themselves and women to hate men. For no good reason. Find me a man who says “women should stay home, barefoot and pregnant!“ or ”women make great secretaries, but that's about it.” No. One. Thinks. That. But we all have to grovel and supplicate to prove we're not one of those sexist straw men our mothers made up.

— kklein @ Slashdot

It starts with a kind of counterculture narcissism that has steadily eroded “left-wing” politics in Canada. It has exchanged solidarity for identity politics, and replaced internationalism with cultural relativism. When you replace critical analysis with a crude anti-Americanism, all that's left is the fashionable radicalism of the liberal elites and the pseudo-leftism of the radical chic.

— Terry Glavin @ The Vancouver Sun

I think you are right to a degree. I have read some of his stuff but quickly became irritated with him. His tone quickly became anyone who doesn't believe is stupid and they believe in nonsense. He made a large number of assertions that morality can only exist because of God, but he relies on a terribly flawed model to make his proof. He ignores the fact that humans by nature are herd/community animals and not loners. Humans tend to go quite insane without other humans around.

The greatest irony for me is that Jesus was VERY vocal about the whole Pharisee approach to the religion. He advocated the “love thy neighbor” and everything else falls into place naturally approach rather than the Pharisees and their “you must follow this monsterous list of rules and rituals” approach. Interestingly enough he also talks about how many of you will have claimed to know me and I will say I have never known you, get away from me. Even from the getgo he predicted that a large number of his “followers” would fall right back into that rules and rituals approach over kindness and compassion. He was ridiculed for spending so much time with the various sinners of his time and his answer was “A healthy man has no need for a doctor.” What is preached today in the name of Christianity is almost identical to the very same religious structure that Jesus fought against.

Dunno about the whole religious aspect of it all, but I think Jesus himself seems to be a pretty good example of how humans should behave. Which is why I think Jesus as a man is more impressive than Jesus as a divine instrument. As a man it means we should all be able to emulate that behavior. As a divine figure it gives the copout crap about how “he died for our sins, all you have to do is accept that”.

Either way my two most favorite things to mess with the overly religious is walking past them as the pass out their bibles, preach on the corner, or pray in public (all of which was specifically advised AGAINST by Jesus “pray alone in your room for when noone else can hear you pray God does”) and saying “Jesus was such a jew” and watching them get up in arms because they are so ignorant of their own faith. The other fun one is a similar exploit, when asked some variant of “Do you accept Jesus?!” I answer something to the effect of “I follow the teachings of Yeshua” and laugh as they blather on about how I must accept Jesus instead.

Most economic fallacies derive from the tendency to assume that there is a fixed pie, that one party can gain only at the expense of another.

— Milton Friedman

Amira; but it does fly in the face of their arguments that; a) the war is not winnable, b) our presence drives ever increasing numbers of Afghans into the Taliban camp, c) that all our boys have died in vain, d) this is just a Western imperialist incursion into a stable and happy Muslim country, and e) we are just America's lapdogs (along with the rest of Western Europe). Now that levels of violence are down in both Iraq and Afghanistan, the possibility becomes real that maybe both countries can become strong enough to withstand attacks from their respective insurgencies, and our soldiers can leave. Then we can help with schools and bridges. But, wouldn't this suggest (gasp!) that the Bush doctrine was in fact correct? Oh, the horror! And you know as well as I do that there are significant numbers of Bush and America haters that would never, ever, admit that. So yes, I do stand by my original comment that this is bad news for some people; those who hate America, Bush, and democracy so much that they do, in fact, desire these missions to fail as miserably as possible.

— Mikethespike @ CBC (2008-06-10)

This story reminds me of a Vancouver entreprenuer who had a small business 25-30 years ago. He had a non-union labour staff that he treated fairly and negotiated deals once a year that were agreed to with a handshake. One day a union (can't remember which one but it might have been CAW) came by and convinced the staff to unionize. Since there was no written agreement the union convinced the workers to strike and force the boss to negotiate a new deal. The first day of pickets the boss didn't come in. After the pickets were gone at night, the boss came in, stored and winterized all his equipment, locked all the doors and gates and walked on a plane to Hawaii. The picket line stayed up for weeks before they realized he was gone and months before they realized he wasn't coming back. Priceless.

— Anthony @ CBC (2008-06-10)

There's room on this earth for all of God's creatures.... Right next to the mashed potatoes.

— ChadLaroche @ CBC (2008-06-02)

They've just worked out that it's cheaper to push a few coders into FOSS projects that are non-core but valuable to their business than it is to pay the MS tax for eternity. Let's face it, computer users have given Microsoft more than 150 billion dollars in the last decade. If they had co-operated and contributed a small fraction of that to a community project, they'd have saved money and got a lot better tool. Plenty of other businesses are starting to come to the same conclusion.

— ozmanjusri @ Slashdot (2008-05-30)

ISO: The best standards money can buy!

Q: How many Microsoft employees does it take to change a light bulb?

A: None. They just change the standard to "Dark".

Most people in the world understand that education [is crucially important], whether it's how to hunt monkeys in the canopy, or how to speak English to guide jungle tours. It's only in relatively wealthy countries with enough infrastructure and social programs that people can afford to stay stupid.

— lawpoop @ Slashdot (2008-05-24)

“Question: Did Mr Einstein ever explain the exact origin of life? Just asking...”

and how exactly do the theists explain it? Adam had two sons... Where exactly did their wives come from?

— RichardFuoco @ CBC (2008-05-13)

I'm interested to know what everyone finds so great about Battlestar Galactica. Is it the unpleasant personalities? The hopeless, bleak despair? The overarching themes of predestination, lack of free will and inevitable doom?

— EGN @ io9 (2008-01-04)

When goods cannot cross borders, armies will.

— Frédéric Bastiat (1801–1850)

[Protectionism is a failed ideology.]

I'm sorry one of your ancestors made a crappy deal a long time ago. I had nothing to do with it and neither did you. You know, my grandfather got a raw deal on a car back in 1979... he's dead now but maybe I should go after that guy who ripped him off. With inflation I'm sure I could get at least $2 Million.

— Brodie21 @ CBC (2008-04-03)

The process was complete, utter, unadulterated bullshit.

— Tim Bray @ tbray.org (2008-02-29), commenting on OOXML at ISO

Using a colloquial tone, professor Dawkins presents many arguments against the God hypothesis. He has frequently been criticized for writing a book on God while not being any kind of theologian; however, he makes no apologies for it as his subject here is not “God the theological construct” but “God the prime mover of the universe”. Another way of putting it is that one doesn't need a degree in “Unicornonology” to argue that unicorns, as a biological species, do not exist.

— B. Leblanc @ Amazon (2007-09-12)

Take the wind industry for instance. Throw a bunch of huge subsidies, tax breaks and easy carbon credits out there and you are going to attract the slimiest shysters imaginable.

No fossil fuel or nuclear plant on the planet has ever been displaced by wind power. In Germany, nearly 19,000 wind turbines cover the country, generating five per cent of its electricity. Yet 26 new coal plants are still planned, and six are on a fast track.

Emissions continue to grow, because the grid has to continue operating as if the wind is not blowing — because more often than not, they aren't generating electricity when there is an actual need.

The wind industry across the world has failed to demonstrate any savings in CO2 emissions at the end of the day. Denmark, the pioneer in the wind industry has actually increased it's CO2 emissions proportionally faster than other European Countries.

Ah, the final weapon of the creationists. If they can find any question, now matter how small, that doesn't have a rock-solid answer, then they loudly proclaim that “HA! YOU SEE?? YOU SEE?? NO ONE KNOWS FOR SURE!!” Any open questions means that every theory is equally valid. It's akin to saying, “Since the Earth's horizon makes it look like a flat disk, therefore, the flat-Earth theory is just as valid as the round-Earth theory.”

Well, every theory ISN'T equally valid. First of all, there is ZERO — ZERO — evidence against evolution. ZERO. There are certainly open questions about how certain things may have evolved, but that means there is a neutral question, not that it's “evidence against” evolution. So you have a Mount Everest of evidence for evolution, a large number of open questions (just the diversity of life and genetics means we're going to have a lot of open questions), zero evidence against evolution, and absolutely ZERO evidence that supports creationism. And, just to top it off, we have an entire planet-sized volume of evidence against the Earth being only 10,000 years old.

I don't know about the rest of you, but I've had enough shovelling and chipping Global Warming off my driveway this winter.

— MRM @ CBC (2008-02-20)

“Your atheism has no basis in actual reality.”

Notwithstanding your rubber & glue counterargument, I would say that accepting objective reality as-is is the very definition of Atheism.

— Citizen of Earth @ Slashdot (2008-02-07)

The reason I point out the Church's sins, and that of most religions, is because it demonstrates rather well that whatever the particular claims of divine inspiration and guidance, religions are like all other human social constructs. There's no effective difference, either in governance or in command structure, between the Roman Catholic Church, China's Peoples Liberation Army or International Business Machines. The only meaningful difference is the leadership's particular claims as to the origins of their authority.

— MightyMartian @ Slashdot (2008-01-31)

Wait, am I suggesting that if I'd had broadband available, I'd've downloaded Windows? Point is, I would never download Vista, but that's mainly because of the incredibly effective antipiracy measures. Namely that it's shit and I don't want it.

— cream wobbly @ Slashdot (2008-01-31)

Yet today, there are few Biblical scholars — from liberal skeptics to conservative evangelicals — who believe that Matthew, Mark, Luke, and John actually wrote the Gospels. Nowhere do the writers of the texts identify themselves by name or claim unambiguously to have known or traveled with Jesus.

— Jeffery L. Sheler, “The Four Gospels”, (U.S. News & World Report, Dec. 10, 1990)

The world has been for a long time engaged in writing lives of Jesus... The library of such books has grown since then. But when we come to examine them, one startling fact confronts us: all of these books relate to a personage concerning whom there does not exist a single scrap of contemporary information — not one! By accepted tradition he was born in the reign of Augustus, the great literary age of the nation of which he was a subject. In the Augustan age historians flourished; poets, orators, critics and travelers abounded. Yet not one mentions the name of Jesus Christ, much less any incident in his life.

— Moncure D. Conway (1832–1907), Modern Thought

Of course we have seen it. It's all around us. It's in the fossil record. By your logic, nobody has actually seen galaxies evolve because they are looking into the past via the fossil record of the universe—radiation (light, X-rays, etc.)

Evolution can be easily traced back to the earliest creatures capable of leaving imprints of themselves behind. The entire process of developing lungs, limbs, spines, etc. etc. is all right there. Each step of the way. It is not a mystery. Just because it doesn't happen in a timespan and a place you personally can witness doesn't make it not so. The sun didn't form before your eyes did it? Did the mountains spring up so you could witness? Is geology a supposition? An educated guess?

You can demonstrate evolution in the lab with bacteria. You can demonstrate complex hydrocarbons doing all sorts of magical stuff in the lab (how life came to be in the first place.)

Tracing the biology of animals of this planet is a well known, well documented science. It is FACT, because the facts are right there in front of the entire worlds eyes, should they choose to look. Fish moving onto land, developing lungs, etc.

We have broken down the DNA code very well at this point, and can trace our origins that way as well. We can see where we differ and what we share with trees, worms, bacteria, dogs and elephants. Natural selection (the mechanism behind evolution) is everywhere as well. Look at dog and cat breeds. Cattle. Plants. Insects. You name it, you can change the creature itself by breeding.

Evolution is science. It is what the facts tell us. This is not a philosophical debate. There are no two sides. It is not a guess. It is about stupidity and blind faith. You can't reject evolution any more than you can reject combustion, or gravity. If people DO reject it, they are simply being ignorant and stupid. Plain and simple.

Basing "science" on something written thousands of years ago by people who were so far from us in their knowledge of the world is ridiculous. It is absurd. Why not simply observe the world? Observe what is right in front of our faces, and learn from it.

— Suicyco @ Slashdot (2008-01-11)

For all the philosophical rambling, none of them, absolutely none of them, escape this simple indisputable fact:

All religious teachings are provided to us by humans.

If God Himself appeared next to me and handed me a copy of the Bible, that would be one thing. But instead, a human handed it to me. And, in fact, a human wrote every word that is in it. This notion of “divine inspiration” (which is supposed to remove the element of human fallibility from the Bible) was communicated to me by ... wait for it ... A HUMAN.

— Anonymous Coward @Slashdot (2008-01-11)

Fight until there isn't a single non-muslim left, and Allah reigns supreme.

— Qur'an 8:39

Anyone leaving Redmond for the search leader is a threat. Not because they'll scurry around collecting company secrets — as if Google's interested in Microsoft's '90s-era technologies. Departing employees, however, might tell other 'Softies how much better Google is.

— Miguel de Icaza (2007-11-11) @Slashdot

Gentlemen and ladies. I hate inflation. I hate taxes and I hate Communism. Do something about it.

— Ronald Reagan, authorizing the end to 15 years of ‘stagflation’ and starting the longest and most powerful bull run in the history of the US stock markets @CTV

[Of course, the economically-illiterate will tell you that Reaganomics didn't work.]

I find it funny that the anarchist protesters out on the hill and at Montebello have a flag.

— Scott in Ottawa (2007-08-21) @CBC

[Perhaps it's because Anarchists are the first to admit that Anarchy doesn't work.]

Let's face it, the violence of the protesters is pure frustration at the public rejection of their bankrupt ideology.

Their inability to get even one like-minded MP elected anywhere in this huge country is indicative of their miniscule numbers and public support. Even the NDP won't touch them with a ten foot pole.

Throwing rocks is the only way to get any press coverage. "Look at me, I'm Che Gueverra!"

Ah, the blissful ignorance of youth.....
— Mike in Hamilton (2007-08-21) @CBC

It is always dissapointing to see Canadians who squander their democratic rights and freedoms with pointless (and often destructive) bike rides and protests. You leave Canadians like me with a sour taste in my mouth and an unfortunate and contiunual reinforcement of my belief that Canadians are spoiled brats who continually underestimate the complexity of the world and the value of our relationship with the US (and Mexico).
— James in Ottawa (2007-08-20) @CBC

The protestors are mostly a collection of people who have re-labeled themselves as activists. In the past they were called malcontents. They usually are focused on a single issue, and rarely have any solutions to anything.

We protect their right to protest and speak their minds, but some of them have interpreted this as permission to incite violence, destroy property, and loot local business.

Gerry in Vancouver might ask himself if he would rather live under an elected dictatorship, or a dictatorship led by unelected "activists". Personally, I would go for the elected variety. At least I can get rid of them the next election.
— Doug in Surrey, B.C. (2007-08-20) @CBC

How come God gets credit whenever something good happens? Where was he when her heart *stopped*!?
— Gregory House, House, M.D. #3-24

Lots of people make the mistake of thinking that Microsoft is a software company. That's wrong. Microsoft is an abuse company that uses software as a method of delivering abuse.
— Futurepower(R) (2007-08-18) @Slashdot

No I am not worried. These things happen all the time. The media has predicted 11 of the last 3 recessions.
— Chris in Alberta (2007-08-16) @CBC

Muslims kill Yazidis because they are not Muslim, yet people blame the USA. Yep, that's logical!
— Joseph in London (2007-08-15) @BBC

On that basis, women marathon runners, who have been catching up with men since the 1920s, were predicted to overtake men in the 1990s, and presumably would be running beyond the speed of light if it were continued for long enough.
— Dr. Helena Cronin @BBC

[Arguing that past statistics give no indication of what might happen in the future.]

IIRC American Indians, many African cultures, and even our old agricultural society were much respectful of the environment.

Bullshit. The American indians simply lacked the technology to have a significant impact on their environment until they got horses, at which point their population expanded and they routinely exhausted hunting grounds, and became far more mobile as a result. As for African cultures, the majority of the Sahara desert became so because of goats, which were protected from predators by humans.

The fact is, it's the industrialized world that first became concerned about the environment, because we're rich enough to have the luxury of considering issues beyond subsistence.
— jcr (2007-08-05) @Slashdot

Is God willing to prevent evil, but not able?
Then he is not omnipotent.
Is he able, but not willing?
Then he is malevolent.
Is he both able and willing?
Then whence commeth evil?
Is he neither able nor willing?
Then why call him god?
— Epicurus (c. 341-271 B.C.)

They [Israel vs. Hezbollah] were trying to fight one of those "kinder, gentler wars". You know, kinda like what we do. First you drop leaflets warning everybody we're going to bomb. Then you allow 48 hours or so for the enemy to depart or dig in. Then you go in with munitions that won't just clear the earth and root out the tunnels and such. Then you send the troops and armor in after the enemy has returned or emerged from the tunnels and has target practice from their secure positions. It doesn't work well.

I suggest send the B-52's with all the bunker-buster weapons without warning and make a wasteland of the enemy's positions. Oh, I know, I know, some civilians are gonna take a hit. BUT, less troops will take a hit when they go in with flame throwers and clear out any remaining snipers and such. THERE IS NO SUBSTITUTE FOR VICTORY.
— JESTGETTINALONG (2007-06-14) @Drudge Retort

Hmmm... see I'm just not the type of guy to look at palestinians killing each other and say, "How is this my fault." The Palestinian people elected terrorists to lead them... there is no law that says we have to keep dumping buckets of cash on them, and if they're going to elect leaders that call for our's and an allies destruction we shouldn't give them money...

We are in no part to blame for this... the blame rests on the heads of the Palestinians who loved and supported Hamas as long as they were killing Jews... now they've turned on the Palestinians... good... fuck 'em all... they deserve it.
— Manypaths (2007-06-14) @Drudge Retort

Stephen Harper is so far up George Bush's ass that he can almost see Tony Blair's feet.
— (unknown)

I'm not misogynistic; I hate whiny bitches of both sexes!
— EraseEraseMe @Slashdot

I think it was Smithsonian that ran an article about the impact of cell phones in Africa and how it improved people's nutrition. It's long been too expensive to run phone lines all across Africa. However, once the mining companies starting throwing up cell towers, poor people got a hold of used cell phones on their own. Now they are lining up buyers for their crops in the field, instead of harvesting them, trotting them all the way to market, and then letting them rot in the hot sun.
— lawpoop @Slashdot

Depends on what your definition of poverty is. Try telling someone impoverished in India or China that most of the "poor" in America are in poverty. Yes, capitalism creates large wealth difference. There's no dirty secret there, that's pretty much the definition of capitalism. But as the rich get richer, they drag the poor up with them. That's why someone in the US who we call "poor" is still one of the most wealthy and privileged human beings in the history of the world.
— bogjobber @Slashdot

Why are Libertarians insane? Because they willfully disregard any evidence that their simplistic theories will not and do not work in the real world. The free market is not magic and infallible. It is a complex system of feedback loops that does not posses any sort of true homeostasis and therefore needs external management in order to maintain its state of freedom.
— spun @Slashdot

Judging from the media in recent months, the debate over global warming is now over. There has been a net warming of the earth over the last century and a half, and our greenhouse gas emissions are contributing at some level. Both of these statements are almost certainly true. What of it? Recently many people have said that the earth is facing a crisis requiring urgent action. This statement has nothing to do with science. There is no compelling evidence that the warming trend we've seen will amount to anything close to catastrophe. What most commentators—and many scientists—seem to miss is that the only thing we can say with certainly about climate is that it changes. The earth is always warming or cooling by as much as a few tenths of a degree a year; periods of constant average temperatures are rare. Looking back on the earth's climate history, it's apparent that there's no such thing as an optimal temperature—a climate at which everything is just right. The current alarm rests on the false assumption not only that we live in a perfect world, temperaturewise, but also that our warming forecasts for the year 2040 are somehow more reliable than the weatherman's forecast for next week.
— Dr. Richard S. Lindzen, Newsweek @msnbc

If you get to be thirty-five and your job still involves wearing a name tag, you've probably made a serious vocational error.
— Dennis Miller

The conflict is between the West and small number of fanatics who think they best way to publicise their racist, anti-Western views is through the medium of indiscriminate mass murder. It does nobody except these fanatics any good to pretend this is a clash of cultures.
— Jack, London @BBC

[Substitute the term "cult" for "fanatics".]

There is somebody right now watching, and God is speaking to them about RRSPs. They've got RRSPs, and they've got a sizable amount, and it's a security thing. Well, it's not a security thing; your security is in God. And God's speaking to you to cash those in. And I dare you to do it.
— The Miracle Channel in Canada fleecing its flock of their savings @CTV

[Convincing proof that there is no God is that He doesn't strike down His supposed ambassadors like this one. An RRSP (Registered Retirement Savings Plan) is an income-tax shelter in Canada.]

First God made idiots. That was for practice. Then He made school boards.
— Mark Twain

Evolution is about as much a theory as the theory of gravity.

But superstition has always guided most major facultative decision making in our times and previously. Witness everything from superstar athelets who run through seemingly bizzare rituals to assure victory, all the way up to "with the grace of God" or "Allah permits" suffixed to the most mundane.

Superstition rules. We make choices daily, big and small almost subconsciously driven by a clockmakers complexity of inner fears and hopes — all unsubstantiated but nevertheless more comforting that a cold reality.

Rational thought is too scary for a great many. As Dave points out above: “Stupid goddam smart people.”

That's the real issue.

The limited number of those who can accept the underpinnings of cold, rational thought can't ever sway the majority who seek comfort in the arms of an irrational belief that promises a reason for everything and a benevolent purpose if one “toes the line”.
— Grendel (2007-01-30) @Drudge Retort

But there's no denying Nader's impact. He invented consumer watchdoggedness and helped wake up a dozing press so that it could become what it is today: a force for general hostility against everything.
— Kyle Smith (2007-01-31) @NYPost

[Also includes a more fun quote: “Those who think Moore stands for something will be disgusted to see him reversing course in 2004 with a cry that voting for Nader is ‘Five minutes of feeling good [but] you gotta pay for it the rest of your life.’ So: Moore actually voted for his conscience before he was against it.”]

It is indeed a sorry situation. One thing that the US and UK learned in Iraq is that there is a bubbling factional enmity among the Arabs that coheres around religious tribal and clan loyalties over national identities. As soon as the Israelis pulled out of Gaza the Palestinians started fighting among themselves. I must say that the trend appears increasingly intractable. Perhaps there is no solution — The Arab countries seem to be so out of step with the rest of the World.
— Graham Lester, London (2007-01-27) @BBC

“One bright morning, in five or 10 years, perhaps during a regional crisis, perhaps out of the blue, a day or a year or five years after Iran's acquisition of the Bomb, the mullahs in Qom will convene in secret session, under a portrait of the steely-eyed Ayatollah Khomeini, and give President Mahmoud Ahmadinejad, by then in his second or third term, the go-ahead,” he wrote.

“With a country the size and shape of Israel (an elongated 20,000 sq km), probably four or five hits will suffice: No more Israel.”
— Israeli historian Benny Morris, quoted by BBC

You failed to do my job for me by protecting my child from his/her own stupidity. Now you must make me rich.
— Anonymous Coward @Slashdot

In the land of the blind, the one-eyed man is usually crucified.
— El Torico

I am also sick and tired of the "Stalin card". Stalin was a magical thinker who had people killed for disagreeing with him, even about science. He also had fewer people straight up murdered than the christian Hitler (most of the millions counted as deaths on stalins head in communist russia starved as a result of his wholesale rejection of agricultural reality), and he invited the church back to Russia when it suited him.

Further, if atheism has to cop to every peasant who starved or died of disease or in prison in Russia and China, lets give Christianity every Native American who died of disease or starvation or in prison, and every European peasant who died as a result of bad economic planning or war or in prison. And lets be fair, and use population adjusted numbers.

The 30 years war alone killed 30% of the European population, the Great Famine between 10-25%. This happened in a christian culture and was worsened through poor management, so christianity gets the blame.

Disease alone killed perhaps 80% of the Native Americans, disease brought by Christians, so again, blame christianity. Stalin and Mao never even approached killing 80% of the populations of their countries!
— jdaigle (2006-12-24) @RichardDawkins.net

[Dogmatic beliefs of any kind are equally dangerous, including the dogmatic beliefs invariably held and practiced by genocidal dictators and their henchmen. And complete faith in dogmatic beliefs is the definition of religion. These dictatorships are merely lessons in religion run amok.]

This is the concentration camp and crematorium at Auschwitz. This is where people were turned into numbers. Into this pond were flushed the ashes of some four million people. And that was not done by gas. It was done by arrogance, it was done by dogma, it was done by ignorance. When people believe that they have absolute knowledge, with no test in reality, this is how they behave. This is what men do when they aspire to the knowledge of gods.
— Jacob Bronowski, The Ascent Of Man

Again back to simplicity, the Christians have already denied a Buddhist, Egyptian, Hindu, or animist god. Atheists (and [The God Delusion]) just eliminate one more. The logic in that is unassailable.
— Sailnsouth (2006-12-26) @RichardDawkins.net

Some ideas are so stupid, only intellectuals would believe them.
— George Orwell

Atheism is a religion like not collecting stamps is a hobby.
— (unknown)

"My hands were shaking after reading this letter," said Kofi Anan. "I mean, this is a REALLY harsh letter. I think North Korea will disarm by the end of the year. My only concern is that it is too strong. We only want North Korea to disarm. This letter might cause them to surrender their entire country to France. The letter is really that strongly worded. I'm shaking even now just thinking about it."
— Jerhad!com (2006-10-13) @Jerhad!com

[Halt or I shall say "Halt" again!]

It's not the lack of resources. It's the Stalinist tyranny and socialist economic system. Only children, simpletons, and power-hungry ideologues believe in socialism any more. It is the ideology of the ant hill and the nursery school playground, unworthy of free men. It takes no more intellectual sophistication to believe in collectivism than to believe in Santa Claus, for the same reason and to the same effect. Collectivism has caused more human misery than any other idea of the human mind. With every vote I cast and every dollar I give to politicians, I am guided by my desire to see it crushed and swept off the face of the earth.
— ccmay (2006-10-23) @Slashdot

[Communism is the longest and most painful path between Democracy and Democracy.]

FUCK A PAPER TRAIL. We need PAPER ELECTIONS. Just that simple. Can paper elections be rigged? Of course they can. Can they be rigged as easily, as invisibly, as completely as digital elections? Hell no. What's mind boggling is that there's even a debate here. Get rid of digital voting machines. Hell, get rid of ANALOG voting machines. Piece of paper, ink pen, padlocked metal box. That's how sane people run elections. The notion of there being anything worth debating here is nothing but complete bullshit.
— Anonymous Coward (2006-10-21) @Slashdot

[As a Doctor of Computer Science, I completely agree. All elections are done on paper in Canada. And counting, even by hand, is a fully parallelizable task.]

Lady, people aren't chocolates. But you know what they are mostly? Bastards. Bastard coated bastards with bastard filling. But I don't find them half as annoying as I find naive, bubble-headed optimists who walk around vomiting sunshine.
— Anniee (2006-08-26)

Hitler was democratically elected. Does that mean that the rest of the world should have financially supported his plans to develop Germany out of post WWI poverty? Who in their right mind can support a group vowed to genocide unless they approve of genocide? Yes, I feel sorry for the Palestinians who are suffering. But democracy equals responsibility. They thought Hamas would solve their problems; they were wrong. Now they have the responsibility to find a solution.
— Mark Nelson, Tallinn, Estonia (2006-10-03) @BBC

[It's interesting how many people feel that Hamas is above reproach since it was democratically elected and that Israel and the western democracies are obligated to fund an organization dedicated to their destruction. Here's the math: Democracy=Good. Terrorism=Bad. Terrorist organization that was democratically elected into power=Still bad, plus has apparatus of state to pursue its terrorist goals. The only thing that being democractically elected with an overwhelming majority proves is that the Palestinian voters definitely DESERVE to suffer the consequences of their choice. Perhaps if the area wasn't so rife with corruption and violence, unauthorized militias and terrorists, a legitimate political party could actually be formed and the voters could have a better choice than corrupt terrorist organization F vs. corrupt terrorist organization H. But this is crazy talk. How could Palestinians ever give up their self-defeating hatred and get on with their lives?]

Seems they can't exist unless they are fighting someone. So, they hate Americans, they hate the Jews, and they hate each other. Now tell me again, WHY should we be expected to fund this bunch of goons? It is simply a welfare state that refuses to admit defeat. They live for a protracted 'war' against the Jews; without it, they have no identity. What a shameful existence.
— P McFall, Atlanta, US (2006-10-03) @BBC

Five years after the September 11 attacks, President Bush told the nation in his televised address, “If we do not defeat these enemies now, we will leave our children to face a Middle East overrun by terrorist states and radical dictators armed with nuclear weapons.” Whether right or wrong, President Bush did not tell us how we will defeat these unspecified and unnamed enemies, nor when.

In response to the president's address, Senate Minority Leader Harry Reid said, “The American people deserved better last night. They deserved a chance to reclaim that sense of unity, purpose and patriotism that swept through our country five years ago.”
— Lou Dobbs (2006-09-13) @CNN

[Bush happens to be telling the truth here. Reid's criticism is that Bush's comments were a downer rather than feel-good back-patting fest and that Reid'd rather not think about such things.]

If the peoples of the Middle East continue on their present path, the suicide bomber may become a metaphor for the whole region, and there will be no escape from a downward spiral of hate and spite, rage and self-pity, poverty and oppression.
— Historian Bernard Lewis, What Went Wrong? (2002) @NPR

Early adopters aren't stupid

Oh, sure we're an impulsive crowd, but most are educated and realize when we've been snookered before.

Did nobody in either camp stop and look at how they had royally screwed every early adopter of HDTV? The promise of content that never occured. The delayed, and delayed, and delayed rollout of OTA. The jumble of formats that caused event the best CE to falter under the load of options. The incompatibilities between components. The ubiquitous component interface that every early adopter had on their display sets which are now utterly obsolete due to the need for “content protection”—a perfectly good $7000 50RP set which may be relegated to 480p at the whim of the broadcaster. The promise of 20Mb HD that got chopped into subchannels to rerun Andy Griffith and the Golden Girls in SD simultaneously, at the expense of HD. The iron fist approach to preventing transferring DVDs to Media Servers.

No, the industry has drawn a line, and the early adopters are on the other side. We're the ones who are most adversely affected by the content protection and market jockying. Don't come to me with your hand out for your improved shovel right after you run over my dog. The industry has, through their anti-piracy efforts, significantly alienated a large portion of their first-run consumers. They've managed to eliminate the initial cash infusion that covers the R&D part of the CE process, and now they're stuck with trying to add enough volume to get every household to buy the product just to cover the engineering costs.

The early adopters want to buy this stuff, but we want to play with our new toys, not see how somebody else want us to play with them. Give us back our control, and we'll open our wallets. 'Til then, go fuck yourselves.
— Overzeetop (2006-09-01) @Slashdot

[HD-DVD vs. Blu-Ray. Perhaps the manufacturers have already fucked themselves.]

Jesus Christ, people, these are recent historical events. A matter in full view, and amply recorded by a variety of sources. This isn't like digging up old records of the Punic Wars or something, it happened just this fucking year.

They didn't launch an invasion on "the pretense" that you state. Since you seem to have missed it, Hezbollah *launched rockets* at a *city* in Israel, and then ambushed an IDF patrol with ATGMs, killing three soldiers and taking two prisoner.

That's not a minor little border skirmish like occasionally happened in Berlin during the Cold War. When you're *launching artillery rockets* at another nation's population centers, there's a word for that: war. When you do something of that sort, you're taking the gloves off. And I think everyone, from the pinkest neo-Marxist socialist feeb, to the most rabid big-L Libertarian nutbat, can agree that one of the *foremost responsibilities* of *any* government is to actually protect its citizens from attack, especially by NGOs firing free-flight artillery rockets from the other side of some line on a map. And *despite* that simple fact, Israel has put up with that kind of thing from Hezbollah for *years*, ever since it withdrew from Southern Lebanon in the first place.

To say this was a reaction to nothing more than the kidnapping of two soldiers is a grotesque and bald-faced mendaciousness on your part.

And even if that's *all* it was, Israel would still have been entirely justified in going after Hezbollah. Nation-states get to do that kind of thing when their citizens are attacked and kidnapped by foreign powers.
— Phanatic1a (2006-08-27) @Slashdot

I've been holding my nose and voting democrat for a long time now merely because I think tax and spend is better than borrow and spend.
— soft_guy (2006-08-24) @Slashdot

This is a statement of such historical ignorance it is utterly astonishing. If pacifists had had their way, Hitler would have had a damn site more than "a small corner of the world". British fighting spirit was not enough alone to keep the Nazi's out of UK. It took American armnaments - a steady stream of them starting well before the US entered the war. I hardly think that it's any more pacifist to send boatloads of tanks and ammunition to Britain than it is to send an armored division, do you? So if pacifism had ruled the day, there would have been no arms to Britain and the island would have fallen.

With Britain out of the picture and America still pacifist there's no Western front. The Soviet army managed to stop the German onslaught by a whisker. Given the complete attention of the Germany army, not to mention the finest German commanders like Rommel who would no longer be dueling the Brits in North Africa, the USSR would have fallen.

Is this your idea of a "small corner of the world"? At this point Germany would have contolled everything form the UK to China to S. Africa. And then why stop there? Why not invade S. America next? It's full of resources, isn't it? What's to stop them? The only thing to stop them would have been Japan, also seeking to expand it's empire. And guess what - that means more violence.
— theStorminMormon (2006-08-15) @Slashdot

[Pacifism is a policy that only looks good on paper.]

Within a framework of civil decency, non-violent protests work. But if the British had really wanted to use violence Ghandi would have been dead with all his followers. His non-violent protests worked in large part because it appealed to the better nature of his fellow and Indians and also the British. Civil disobedience and other forms of non-violent resistance require framework and leverage that simply does not always exist, and in the end they put you in the mercy of the person you're trying to resist. If that person really wants you dead, then these tactics will fail miserably.
— theStorminMormon (2006-08-15) @Slashdot

[The other canonical case for Pacifism. It requires an *extremely* "sympathetic target" to have any effect other than your wholesale slaughter. Strangely, many liberals consider radical Islamic terrorists to be an ideal target.]

Karl Marx is to philosophy what Reverend Jim Jones is to religion.
— (unknown)

I do really love to see all of these Arab leaders begging for C. Rice to come save them from Israel though. I notice she tends to wear skirts to the meetings—really makes me happy!
— ILikeRed (2006-08-10) @Slashdot

Don't Cubans deserve the same the same human rights and freedoms of speech as Castro's sycophants?
— Yvonne, New York City (2006-08-03) @BBC

[BBC's Have Your Say is always an entertaining place. I was thinking that maybe half of the message posters would be critical of the western hemisphere's sole dictator, but it was only about 10%. Clearly, I had underestimated the liberal-minded people's love affair with totalitarian dictatorships. I guess they're great so long as you don't have to live in one yourself. (No, I mean *actual* totalitarian dictatorships, not what liberal types like to call America.)]

[More BBC Have Your Say.]

I always wonder this. I mean, I belive there is a [God], but I don't know for sure. I guess it's just what you want to believe. Beliveving in the Lord has given me faith many times, and I feel like he has helped me when I need it most. I know it could be my imagination, but it makes me feel better to believe it. So I believe it.
— xbabibluangelx (2006-08-02) @IMDB

[This person sums up the religious position of probably a lot of people. I wish *I* had the power to choose what I believe. That would be extremely convenient! Maybe this is the layman's superpower.]

People have noticed [the UN Security Council's] failure to act firmly and quickly during this crisis. I am deeply dismayed that my earlier calls for the immediate cessation of hostilities were not heeded, with the result that innocent life continues to be taken and innocent civilians continue to suffer.
— Kofi Annan (2006-07-30) @CNN

[I really can't see why Annan would be "deeply dismayed" by this. Nobody takes the UN or Security Council seriously. I personally would be flabbergasted if the Council ever did act quickly or firmly on anything or if any side of a conflict ever took it serously. You'd think that Annan would be used to being ignored.]

Young women today are like superheroes in the first pages of the comic book, blessed with incredible powers and not yet aware of the responsibilities that come with them. Garbarino is no reactionary preaching from the same book as the Concerned Women for America, and his prescription for this cultural conundrum is not the kryptonite of post-feminist retreat to the cotillion—and then the kitchen. Anti-feminists were wrong, anyway. Freeing girls from stereotypes hasn't made them more masculine; it's made them more more. Unbound from cultural constraints, they don't flip to the male side of the spectrum. They just flip out.
— Ana Marie Cox (2006-05-23) @Time

Muslim extremists kill our neighbours and murder our friends. They march through our cities inciting religious hatred. They glorify suicide bombing and attack the very freedoms our society is founded upon. Then they expect us to be outraged when one of their militias comes under attack. I'm sorry, but my sympathies are elsewhere.
— Anthony Karas (2006-07-18) @BBC

[Goodness, can one possibly hope for a Muslim backlash against terrorism?]

Just imagine that the Mexicans lobbed missile after missile into Texas and California. Would we just say, well, they are poor and oppressed people? No, we would take the actions necessary to protect our citizens. Consider the troubles in the UK, did the UK accept the IRA position, or actively try to hunt them down and bring them to justice?
— Jack (2006-07-14) @BBC

[My canonical example would be Cuba, considering that it is tiny, weak, hostile, and perhaps crazy enough to try such a thing, considering that Castro realizes he is not going to live forever and has been ratcheting up his rhetoric lately. But, you still get a taste of the hypocrisy of American pacifists. “Other first-world democracies should absorb attack after attack from terrorists, but when anyone tries that to us, WE KICK THEIR ASSES!”

The real reason that the Israeli-Arab conflict has lasted so long is that the US has always restrained Israel from conquering its enemies. And it will again, because some dangerously naive people have the bizarre fantasy in their heads that there can be a negotiated peace with radical terrorists. If we really believe such things, then we should let all of our own psychotic serial killers back out onto the streets after they agree not to kill any more people. And let them back out again and again when they do.]

“Israel in Lebanon—where will it end?”

It will end with the destruction of two ancient nations, Iran and Syria. Future historians will say they were destroyed by Israeli nuclear weapons but future philosophers will know they were really destroyed by being consumed with their own hatred and intolerance.
— Mark (2006-07-14) @BBC

ACTTTTTCGCGAGAGGAGAGTGAGT//todo:this should only return a positive values!AAAAAATTTCTATCTACTATCTACATATCATTACA/*warnin g we are kluding around the antique "arthropod" module, here there be bugs!*/AAAACTCTTATCTATTTATTCATCTATCATTCATCTATCATCT ACTACTATCTAATCTATACA//haha nice hackACTCTACTATAGATCGATGT
— ggvaidya (2006-05-18) @Slashdot

[A fragment of human DNA, the source code of life.]

If I had wanted a lowest-common-denominator, unionized job, I would have gone to trade school, become a machinist, and made auto parts for a living. Oh wait — all those companies, that whole freaking industry is going out of business in this country, because of the way the Unions have driven the cost of production through the roof. I hope they've had a good run, because they've collective-bargained themselves out of a job.
— Kadin2048 (2006-05-11) @Slashdot

[If I can't do my job better than anyone else available in the world, then I don't deserve it.]

"Pure racism! They don't want brown people to be treated like humans. Typical American behavior." — Howard Felton, London

So Howard, if I'm brown and break into your house, are you racist if you ask me to leave?
— Erv Lawrence @BBC

[Illegal immigrants.]

I know when I am annoyed by something I'm more likely to resist. For example, whenever I meet militant PETA people I really want to go kill baby bunnies, skin them, and wear their bloody firs as a coat... and I'm vegetarian!
— goofyheadedpunk @Slashdot

Remember, anyone can juggle for a second.
— John Alejandro King @covertcomic

It's dangerous to be right when the government is wrong. Or at least it would be, if the government was ever wrong.
— John Alejandro King @covertcomic

Zacarias Moussaoui is a paranoid schizophrenic with delusional beliefs, a defence psychologist told the trial of the convicted Sept. 11 conspirator.
— CBC News (2006-04-18) @CBC

[Come now, we can't accept this as a defence—because every religious person can be described in exactly the same way. We can't let them all walk.]

Easter and the concept of “Intelligent Delivery”:

On one side, there are the people who believe that the Easter Bunny delivers eggs and candies on Easter.

On the other side, there are those who say that there is no Easter Bunny. The eggs and candies are delivered/hidden by other humans.

If you want closed-mindedness, it exists on both sides of this issue.

Damn those Easter Bunny deniers and their closed minds! Damn those secular “Human Deliverers”.

You say that “Intelligent Delivery” is the “middle ground”. The existance of the Holy Hopper is not questioned. But he delivers the eggs and candies through his influencing human minds.

The Written Rabbit tells us only that He does deliver the eggs. It does not say HOW he delivers them. Intelligent Delivery is the answer.
— khasim (2006-03-26) @Slashdot

If it's native tribes conducting the [harp seal] cull, then it's a wonderful example of multicultural diversity. If white men do it then they are evil bullies compensating for inadequacies elsewhere in their lives. If white women do it then they are sassy and independent and to be admired. I think that covers it.
— Mike Davies, Bury, UK (2006-03-23) @BBC

The California Condor is on the verge of extinction. It is also very ugly. No one cares.
— [Mysturji], Basingstoke, UK (2006-03-23) @BBC

[OTOH, those baby seals are soooo cute.]

That's more a sign of the times really. A doctor now has to think twice about helping after an accident: the victim might one day sue. Another example of this sort of thing is lost children; if I see a lost child I am staying the hell away and not helping them. Previously, I'd speak to them and try to find a cop or store clerk that could help. Now I'm just frightened of being accused of being a pervert or child abductor. Your lost children are on their own, it's just not worth the risk to help them anymore.
— glesga_kiss (2006-03-09) @Slashdot

Anthropic principle: We see the universe the way it is because if it were different we would not be here to see it.
— proverb

Why do men earn more money than women? Because they deserve to.
— Reed Business Information @Amazon

[The facts that lefties don't want you to know. Continued: “Men work longer hours at more dangerous and disagreeable jobs. They more readily accept night shifts, hardship postings to Alaska and entrepreneurial risks. Men get in-demand degrees in engineering, while women get degrees in French literature. Female librarians earn less than garbagemen, not because of discrimination, but because so many applicants compete for the safe, clean, comfortable, convenient, fulfilling jobs women prefer. Indeed, the author insists, statistics show that women and men with equal experience and qualifications, doing the same job, for the same hours, under the same conditions—get paid the same.”

It doesn't even make sense that women would get paid less for the same work. In today's world of cut-throat business competition, if a company could get the same quality of workforce by paying only 75% as much—IT WOULD! Big-time!! Women would be so outrageously in demand that it would cause their salaries to rise; macroeconomic pressures are unavoidable. The guilty parties at keeping women's salaries lower—are women. In aggregate, women simply have different priorities from men, and this is not necessarily the Bad Thing™ that Female Supremists would have you believe.]

Just one piece of advice about Love.... DON'T LISTEN TO ADVICE ABOUT LOVE! :)
— Oliver, Paris (2006-02-14)

Doctor: Well, I'm afraid you have tuberculosis. I need to know, are you a creationist?
Patient: What does that have to do with anything?
D: Well, I could give you the drugs that would cure Tuberculosis as it was discovered in 1937, or the modern drugs that treat the disease as it has evolved into today.
P: What's so great about the modern drugs?
D: They're intelligently designed...
— Doonesbury

“If our Muslim community wishes to boycott Danish products as an act of protest, the question is, why stop at Denmark? Why not start with American products?” the Congress said in a statement this week. “After all, it is the United States that occupies two Muslim countries, not Denmark.

“Where will this boycott stop? Will we stop buying French, German, Italian, Spanish and Norwegian products as well? After all, newspapers in these countries too have printed the cartoons.

“Many Muslim governments, led by dictators and kings, have fanned this selected sense of outrage against Danish food products. Their campaign reeks of hypocrisy and false bravado. After all, it is easy to give up on Danish cheese, but who will hand over their Microsoft products, their iMacs or their Mercedes cars. Not Hosni Mubarik, and definitely not King Abdullah or President Assad of Syria.”

The irony of this violence is that the most offensive of the cartoons shows prophet Muhammad with a bomb on his head — suggesting that Muslims are violent and aggressive. This was an opportunity for the Muslim community to disprove the stereotype by not retaliating with violence. But instead the extremists proved the cartoonists and editors right by taking violent protests to the streets, behaving completely irrationally, torching embassies, buildings and flags, and even causing the loss of life.

I asked Naser Khader why the extremists fell for the bait and why they encourage the conflict.

“Extremists can't live without enemies,” he says. “They cannot live without conflict. When you don't have an enemy or conflict, you can't get support and these guys can't exist without it”.
— Natasha Fatah (2006-02-10), quoting the Muslim Canadian Congress @CBC

[One note on language usage: in order for something to be ‘ironic,’ it must be unexpected.]

If you had been Danish, we'd kill you.
— some Lebanese protester to a Norwegian journalist

Computer Science is the bastard child of Electrical Engineering and Mathematics.
— Albert Wong? @UBC

[Aww, and I thought I had coined that description, though I put Mathematics first.]

Every time I hear someone say, “But it's only a theory, not a fact” I cringe and then immediately ask them if they have a problem with the Theory of Electromagnetism or the Theory of General Relativity since they too are “just theories” and not facts. The usual response is a blank stare as their mind tries to not assplode from having to defend such a ridiculous statement.
— smooth wombat (2006-02-08) @Slashdot

[Bruce's Law: You can always count on laypeople to be too stupid to understand what a scientific theory is.]

> Are you serious or is the site just satire?
Nothing is just satire.
— intellectualwhores.com

Angela Dodson: I guess God has a plan for all of us.
John Constantine: God's a kid with an ant farm, lady. He's not planning anything.
— Constantine (2005)

They say love should be unconditional. That's...stupid. Love is too precious to be unconditional.
— Jason MacIsaac (2002), Nice Guys Finish Last

Most people in the west know Islam by what we observe. We see killers fly planes into buildings, take over schools, blow up, behead and murder innocent people, including children. The killers commit these crimes under the authority of a religion—Islam. A cartoon shows Mohamed with a bomb in his turban. Muslims are mad at the wrong people. The killers are now the image of Islam. If the killers are not the true representatives of Islam, then Muslim furor should be directed at the killers.
— Chuck Green, Dallas, Texas, USA (2006-02-02) @BBC

Now the “militants” are the militia of the ruling party. They are one and the same with the Palestinian Authority. If they bomb Israel from Gaza — not under occupation anymore, and is therefore, technically, part of the Palestinian state the PLO proclaimed in Algiers in 1988, but never bothered to take responsibility for — that is an act of war, which can be responded to in kind, under the full cover of the internationally recognized right of self-defense. No more excuses that the Palestinians live under occupation, that the PA is too weak to disarm Hamas, that violence is not the policy of the PA.
— Emanuele Ottolenghi, National Review (2006-01-26)

[Perhaps more has been gained than lost. Majority victory is not at all what Hamas wanted. There is no more hiding behind the Palestinian Authority when attacking Israel and no crying to mommy when Israel squishes them like a grape in the war that Hamas starts.]

[Update July 2006: It didn't take long.]

Generally, file systems are not considered “sexy.” When a young programmer wants to do something really cool, his or her first thought is generally not “Dude, two words... file system.” However, I am what is politely termed “different.”
— Narayan Newton (2006-01-25), Mad Pengiun

[Even nerds have nerds.]

A theocratic country should not have nuclear technology.
— D Gorgerino, Paraguay @BBC

I'm convinced that the universe has been created by someone with a particularly vile sense of humor. I would like to propose a theory of “intelligent malicious asshole design.”
— Antares

Actually, Microsoft has a lot of commercial interest in the Win32-platform (Windows-licenses, MSDN-subscriptions, courses, etc.) which is of course endangered by the Web.

That is why they wanted to establish their own network (MSN) with their own proprietary protocols and their own proprietary formats. They failed miserably and now MSN is just a normal ISP and uses Unix protocols and formats like anybody else. Microsoft did not “win” the Browser war; the whole Internet Explorer thing was damage control. After Netscape was dead, Microsoft was stuck with something they didn't really want. (An IE that was dominating but was running with open protocols and formats.) The better IE is, the more attractive the web becomes in comparison to Win32. So of course they let it rot, making IE better would have been counterproductive.

After Firefox started to destroy domination by becoming so big that it can no longer be ignored (over 10% and rising is too much to ignore, even if it's still a minority) therefore Microsoft fell back to damage control mode.
— RoLi (2005-11-29) @Slashdot

It's one thing to say that a flu pandemic is inevitable. But then, so are earthquakes, volcano eruptions, giant asteroids, and the heat death of the universe....
— Tim (2005-11-13) @Slashdot

The children now love luxury; they have bad manners, contempt for authority; they show disrespect for elders and love chatter in place of exercise. Children are now tyrants, not the servants of their households. They no longer rise when elders enter the room. They contradict their parents, chatter before company, gobble up dainties at the table, cross their legs, and tyrannize their teachers.
— Socrates (470 BC–399 BC)

I knew I'd hate COBOL the moment I saw they'd used ‘perform’ instead of ‘do’.
— attributed to Larry Wall

Organizations almost always try to skip steps in this process. It's very tempting to do. They think to themselves, “No one would buy version 1—it's too basic. Let's throw in at least a few version 3 features, and maybe a version 4 feature. That will make our product sexy enough to sell.” But if you can't find anyone who needs version 1 of your product—desperately—you've built the wrong product, and no amount of polish or number of added features will change that.
— Charlie Wood @Moonwatcher (2005-08-17)

What has gone wrong? Microsoft, with $40 billion in sales and 60,000 employees, has grown musclebound and bureaucratic. Some current and former employees describe a stultifying world of 14-hour strategy sessions, endless business reviews and a preoccupation with PowerPoint slides; of laborious job evaluations, hundreds of e-mails a day and infighting among divisions so fierce that it hobbles design and delays product releases. In short, they describe precisely the behavior that humbled another tech giant: IBM in the late 1980s. Tellingly, IBM reached a point of crisis just over three decades after it started selling computers to commercial users.
— Victoria Murphy @Forbes (2005-09-13)

Any sufficiently advanced incompetence is indistinguishable from malice.
— AC @Slashdot (2005-09)

Perhaps we shouldn't rebuild on the lands that keep getting destroyed... I hear that's what they did in the days before governmental disaster relief.
— slughead @Slashdot (2005-09)

Given enough time and money, eventually Microsoft will re-invent Unix.
— (unknown)

[Or: "Windows is the longest and most painful path between Unix and Unix.]

The purpose of the office of the president is not to wield power, but to draw attention away from it.
— Douglas Adams

Just because your idea of Philosophy is something to talk about while you're smoking pot, doesn't mean that's all there is to it.
— SatanicPuppy @Slashdot

Technically, things may be going fantastically. It doesn't matter. The whole mission is about "Don't screw up! Don't screw up!" and every future mission will be "Don't screw up! Don't screw up!" until inevitably something does get screwed up. Every flight will consist of going into space to do the equivalent of refinishing a bathroom floor.

If NASA starts something new and ambitious with a clear, exciting goal — the media and public will be able to accept risk the way they did with Mercury, Apollo and the early shuttle program. But sending people into space purely for the goal of not killing them? It's a dead end.
— Otter @Slashdot

[The USA is no longer in the manned space-exploration business. Man's only hope for getting off this rock lies with China now.]

The IRA has shown itself to be completely untrustworthy in the past, and any declaration that it now makes needs to be viewed with scepticism.

Prior avowals of giving up violence as its method to achieve its aim have proven to be meaningless, with further murders occuring in less than a week of its declaration.

Gerry Adams of the Sinn Fein has long denied any ongoing membership in the IRA's directorate, yet one now reads that he has agreed to step down from the council that has been the command of the IRA.

A most wily politician, adept at double-talk that seldom ever clearly answers the questions asked, his obvious charisma and powers of persuasion have fooled the Americans and stymied the British for far too long. Previous promises to decommision arms have not come to fruition, with his declaring that such would be conducted in secret, with no accountability or outside witness to the fact.

He has claimed that his political party is a seperate entity to the IRA, does not control the army or shape and direct its future actions, but merely acts in an advisory capacity for the good of all Irish people in the quest to unite Ireland - against the will of the Ulster people - come what may.

It is surely obvious that the political wing and the armed wing are joined at the hip, are the two parts of the whole - an entity that has killed over 3000 people, the majority of whom were the native Irish themselves. The present iteration of downing arms and ending murders makes for good copy, but in reality who can trust the words of such a man, when viewed in his historical perspective?
— Jeremy Fuller @CBC

[Don't worry—the IRA are the *good* terrorists, the *cuddly* mass murderers.]

For years, there was a widely held belief that Britain's tolerance helped stave off any Islamic attacks at home. But the anger of London's militant clerics turned on Britain after it offered unwavering support for the American-led invasion of Iraq. On Thursday morning, an attack long foreseen by worried counterterrorism officials became a reality.
— Elaine Sciolino, et al. (2005-07-10) @NYT

[Terrorists (and other criminals) always bite the hands that feed them. This will happen to Canada, too.]

We no longer stand on the shoulers of giants because we are crippled by midgets.
— Black Art @Slashdot

[Mr. Art sees the innovation processing being hobbled by patents and the first-to-file race. “There is a large amount of huberis involved with the patent process that says 'no one is as smart as me, so anyone who has a similar idea to mine must be stealing it'. The problem is that when you have large numbers of people working on the same problems, you are going to encounter the same solutions over and over again.”]

Wow, I'm being shot at from both sides. That means I *must* be right. :-)
— Larry Wall in <199710211959.MAA18990@wall.org>

/* And you'll never guess what the dog had */
/* in its mouth... */
— Larry Wall in stab.c from the perl source code

I am sick with this. What eBay are doing is profiteering on the backs of the impoverished. The people who are selling it are wretches. But far worse is the corporate culture which capitalizes on people's misery.
— Bob Geldof, on people selling charity Live-8 concert tickets on eBay (2005-06-14) @BBC

[Don't look now, Bob, but you're guilty of exactly the same thing. Funny how much riding room there is on the backs of the impoverished.]

Once again, the hungry, terrorised, children of Africa are pooling their efforts to help others. They will, once more, perform on our TV screens to help rescue the sagging reputations of that needy and deprived group of balding, clapped-out rock stars who still long for the crowds that once listened to them.
— Peter Hitchens in the Mail on Sunday (2005-06-12), commenting on Bob Geldof's Live-8 concerts

There's really very little difference between radical environmentalists and religious fundamentalists. Both want to control what everyone else does and thinks based on their own unreasonable and unprovable beliefs. “The end of the world is nigh” indeed.
— PaxTech @ Slashdot (2005-06-10)

As an African, I am full of anger knowing that my people have become mere pawns in this very cynical and self-serving antic of doing something for Africa—whatever this means. This is a game in which the real obstacles to our people's economic emancipation (i.e., African rulers) are gratuitously indulged at every opportunity, while our people become increasingly poorer.

I just wish that the Blairs and the Geldofs of this world would stop exploiting my people's suffering in this way. It is, after all, the case, that no impoverished African has ever asked anyone for aid. If the Blairs and the Geldofs of this world cannot join us in demanding responsible governance on our continent, I say, leave us alone; stop prolonging our suffering with these antics. Enough is enough!
— UE, UK/Nigeria (2005-06-06), about the Live-8 concerts @BBC

[Won't the bleeding hearts and artists be shocked to discover that five years from now the people of Africa are just as poor as they were today, thier despotic rulers are richer, and there are more wars being fought on the continent and more acts of genocide being carried out. Whatever will they do then? Hold another set of concerts, of course. Donating money to dictators is an endless source of self-promotion.]

This is how liberty dies—with thunderous applause.
— Senator Padmé Naberrie Amidala Skywalker, Revenge of the Sith

[I think George could have made his Dubya dig better by having Padmé start with “So this is how democracy dies—”. “Liberty” is too abstract a concept.]

Did you hear about the special edition of Raiders Of The Lost Ark? The guy with the scimitar shoots first.
— nomadic

Fox exec Andy Setos told me that we were there to create “a polite marketplace” where no one would be allowed to disrupt his [digital television] business model without getting his permission and cooperation first (*cough* planned economy *cough* commies *cough*).
— Cory Doctorow on BoingBoing

We are all self-made, but only the rich will admit it.
— (unknown)

The most brilliant propagandist technique will yield no success unless one fundamental principle is borne in mind constantly... it must confine itself to a few points and repeat them over and over.
— Joseph Goebbels - Nazi Minister of Propaganda

People tend to overestimate change in the short term and underestimate it in the long term.
— Robert X. Cringely (1997-06-12), apparently quoting “Amara's Law”

Does the UN need an overhaul? Somebody has a sense of humour. It needs scrapping. It serves no useful purpose and has failed at nearly every opportunity when it could have done something. As it stands it is a very expensive ‘talking shop’ and a stage for tin-pot dictators and genocidal regimes to ‘strut their stuff’.
— John, France (2005-03-21)

“People are nervously asking themselves a question: Could [President Bush] possibly have been right? The short answer is yes,” wrote Fareed Zakaria, author of The Future of Freedom, in Newsweek magazine.

“Bush never accepted the view that Islamic terrorism had its roots in religion or culture or the Arab-Israeli conflict.

“Instead he veered toward the analysis that the region was breeding terror because it had developed deep dysfunctions caused by decades of repression and an almost total lack of political, economic and social modernization,” Mr Zakaria wrote.
— BBC article (2005-03-08)

Monogamy: Belief so strong that millions of people end perfectly good relationships in order to start another.
— (unknown)

There are those who say, “Well, if you didn't go into Iraq, there wouldn't be terrorists there.” They weren't some place drinking tea and playing Scrabble. These are hardened Jihadists who will fight us some place. And if they want to fight us in Iraq, where we are 140,000 strong, better there than in New York City again.
— Condoleezza Rice

I wonder.... Can Darl McBride drink a glass of water while Maureen O'Gara speaks?
— roadfrisbee @ Groklaw.net (2005-02-23)

[Or, insert your favorite corporate con-artist/sycophant “jouralist” pair.]

Its easy to understand why the cat has eclipsed the dog as modern America's favorite pet. People like pets to possess the same qualities they do. Cats are irresponsible and recognize no authority, yet are completely dependent on others for their material needs. Cats cannot be made to do anything useful. Cats are mean for the fun of it.
— P.J. O'Rourke

Now, now my good man, this is no time for making enemies.
— Voltaire (1694-1778), on his deathbed in response to a priest asking that he renounce Satan.

If God didn't exist, it would be necessary to invent him.
— Voltaire

Anyone who has the power to make you believe absurdities has the power to make you commit injustices.
— Voltaire(?)

(*cough* priests *cough*!)

It is the final proof of God's omnipotence that he need not exist in order to save us.
— Peter De Vries

[And here I, as a mathematician, always believed that zero times infinity is zero.]

It only takes 20 years for a liberal to become a conservative without changing a single idea.
— Robert Anton Wilson

Just goes to show that a great company with a great reputation, skilled professionals, and a solid product line are no match for really bad management.
— rip (2005-02-09), referring to CEO Carly Fiorina stepping down from HP

The whole religious complexion of the modern world is due to the absence from Jerusalem of a lunatic asylum.
— Havelock Ellis, 1914

So often underestimated, so often triumphant over his grovelling critics. Take heed those who only live to complain and criticize. He's at it again! God bless President Bush.
— Brian, Duluth, MN, USA (on BBC.com relative to Bush's 2005 State of the Union Address)

[I think that history will record Bush, Jr. as being a Reagan with balls. Lefties love to stew in their hatred for the man, but what will their excuses be when Bush prevails? What are their excuses for opposing the man who busted the Soviet Union? “Aw, the Soviets weren't so bad and living in the shadow of nuclear armageddon gave every day extra zest.”?]

Anyone who calls President Bush a liar does not understand the times or the higher calling he made to all free nations to join in the war on terrorism. Iraqis found WMD—“Western Made Democracy” and they showed how much they are willing to sacrifice for it. Meanwhile the IRA continues to dictate terms to the British government and bring down the true wealth of the United Kingdom.
— Carlton, USA (2005-01-31), in the wake of democratic elections in Iraq

Let every nation know whether it wishes us well, or ill, that we shall pay any price, bear any burden, meet any hardship, support any friend, oppose any foe to assure the survival and the success of liberty.
— President John F. Kennedy

[A lefty who understood that totalitarian dictatorships are bad news.]

In Pierre Trudeau, Canada has finally produced a Prime Minister worthy of assassination.
— John Diefenbaker

Religion is a by-product of fear. For much of human history, it may have been a necessary evil, but why was it more evil than necessary? Isn't killing people in the name of God a pretty good definition of insanity?
— Arthur C. Clarke

Suppose we've chosen the wrong god. Every time we go to church we're just making him madder and madder.
-- Homer Simpson

Doubt is not a pleasant condition, but certainty is absurd.
-- Voltaire

Yet, through it all, Sun was still partying like it was 1999. We all know that Sun's executives got the memo about many of its customers not wanting to buy servers that cost more than most luxury cars that are no faster and no more reliable than a typical Dell server. [...]

Sun doesn't have the mindshare of the next generation of unix/linux gurus, those who learned on linux on their home PC, not in some computer room on a donated sparcstation. And when you go from linux to Solaris, you're in for a rude awakening. The default userland of Solaris is still stuck in the early 80s for the most part, thanks to an adherence to backwards compatibility that borders on fanaticism.
-- tots (2004-09-30) "Setting Sun"

[Tell it like it is, brother! Amen.]

"... Because of the value that comes from the ambiguity of what the U.S. may do to an adversary if the acts we seek to deter are carried out, it hurts to portray ourselves as too fully rational and cool-headed ..." "The fact that some elements (of the U.S. government) may appear to be potentially 'out of control' can be beneficial to creating and reinforcing fears and doubts within the minds of an adversary's decision makers ..." "That the U.S. may become irrational and vindictive if its vital interests are attacked should be a part of the national persona we project to all adversaries."
-- A CNN Report on a 1995 study "Essentials of Post-Cold War Deterrence" by the USA Defense Department's Strategic Command

The 1611 King James version, perhaps the most famous book ever written by a committee, may reach poetic heights, but Alter says it is fraught with "embarrassing inaccuracies" and often substitutes Greek or Latin words and Renaissance English tonalities and rhythms for biblical ones.
-- CNN (2004-11-18)

[Trouble brewing... If you were an indoctrinated fool, how would you feel to discover that the King James bible is not the "Word of God" but rather the word of a committee. Also, definitely do not do a web search on the "Council of Nicea"... another committee, which formed the whole of the religious canon of Christianity from selected letters written by fanatical cult members over three hundred years before. Christ's divinity was decided by a majority vote of the men present.]

Without Arafat, the Palestinians would not have got as far as they did. But with him, and because of him, they were unable to get any further.
-- Ha'aretz, Israel (2004-11-12)

In the end, Yasser Arafat harmed the Palestinian cause... His death now offers the Palestinians an opportunity to free themselves from the autocratic and corrupt structures of an apparatus which has become an end in itself.
-- Die Welt, Germany (2004-11-12)

Expecting that a new page will be opened by Arafat's death means thinking that the only obstacle to peace was Arafat. How wrong... Peace can only be possible by compromise on both sides.
-- Hurriyet, Turkey (2004-11-12)

Arafat has consistently thrown away chances for peace during his leadership. He is an egocentric man who could have seen peace in his lifetime had his own image been less important to him than what was best for his people.
-- Dan, Windsor, UK (2004-11-05)

[Arafat: The man who never missed an opportunity to miss an opportunity.]

Oxymoron of the Day: 'Democratic Imperialism'.
-- unknown

[We shall bludgeon them with freedom, maim them with rights, and strangle them with prosperity. The streets shall flow with rivers of self-determination!]

The purest form of joy in Islam is to kill and be killed for Allah.
-- Iranian Ayatollah Khomeini

If most financial analysts watched a puppy growing for the first month of its life, they would conclude that a year later it will be 400-foot-tall monster trashing downtown Tokyo.
-- unknown

Right now, I'm devoting a great deal of time and study to that problem. And I intend to issue a position paper on that. A position that is at once simple, yet complex; firm, yet flexible; and above all, fair to every American.
-- Les Nessman, WKRP in Cincinnati

[Also, Senator Kerry's answer to most difficult questions (2004-10-22).]

When you're young, you look at television and think: There's a conspiracy. The networks have conspired to dumb us down. But when you get a little older, you realize that's not true. The networks are in business to give people exactly what they want. That's a far more depressing thought. Conspiracy is optimistic! You can shoot the bastards! We can have a revolution! But the networks are really in business to give people what they want. It's the truth.
-- Steve Jobs

A nation that coins the phrase "road rage" and watches reality TV shouldn't be surprised when its elected officials are less than civil.
-- CNN (2004-10-15)

In 1972, Peter Gzowski, then summer host of This Country in the Morning, held a contest to complete (in the manner of "As American as apple pie") the saying "As Canadian as...". Heather Scott, a seventeen-year-old summer music school student at the time, heard of the contest, and immediately came up with the phrase that has since become so famous. "As Canadian as... possible under the circumstances."
-- R. W. Scott, Heather's father (2004-05-18)

In Lebanon, some student members of the terrorist group Hezbollah have asked if there was any way they could support the film. Gianluca Chacra, the managing director of Front Row Entertainment, the Middle East distributor for Fahrenheit 9/11, has stated, "We can't go against these organizations, as they could strongly boycott the film in Lebanon and Syria. Having the support of such an entity in Lebanon is quite significant for that market and not at all controversial. I think it's quite natural."
-- Wikipedia

[Fahrenheit 9/11 -- Hezbollah approved! Here's hoping Michael Moore makes hundreds of millions more in the Middle East by inspiring a new generation of terrorists. He has no qualms about accepting blood money, right? Green is green when you are a cynical, self-serving, narcissistic and sleazy business man like Moore. Oh, and hypocritical, too.]

[Correction (2006-08-14): It looks like the new generation of terrorists that Michael Moore & The Liberal Hysteria (catchy rock-band name?) have inspired is the children of Islamic immigrants to first-world democracies. The Mullahs thank the western media for reinforcing the idea that the west is wicked and must be punished.]

Fascists divide in two categories: the fascists and the anti-fascists.
-- Ennio Flaiano

The prospect of technological leverage will of course raise the specter of unemployment. I'm surprised people still worry about this. After centuries of supposedly job-killing innovations, the number of jobs is within ten percent of the number of people who want them. This can't be a coincidence.
-- Paul Graham (2004-09), What The Bubble Got Right

[If the doom-sayers were right, there would only be ten jobs in the world today.]

So when the announcement was made at a press conference in the UK that Newham, a borough of London, had just decided not to go open source after all and instead to sign on with Microsoft because their software was cheaper than open source and more secure, the room spontaneously burst out laughing.
-- Pamela Jones, Groklaw (2004-08-17)

[Tee-hee-hee. It's a sure sign that something is well-known when even journalists get it.]

The anti-globalization crowd is about the most hypocritic bunch of people without any clue about what they're talking ever (mostly liberal arts crowd without even the most basic understanding of economics and usually no need to have it anyhow cause their parents will pay for their life one way or another) I can think of. They'll hold global meetings claiming that other people who do the same have no right to do so (I'm not even going into discussing just how good PR it is to blow up cars and McDonalds stores). It's also most interesting that the people affected the most by globalization (low class, factory workers and the like) aren't nearly as vocal about it as the people who BENEFIT of it.

The only (proveable, BTW) way to get the 3rd world up to speed (aside of pumping trillions of dollars down there which in the end would be spent on weapons or trickle into some corrupt leaders pocket anyhow) would be to drop all protectionist duty on agricultural goods, essentially kicking *up* globalization a few notches, not trying to slow it down. But seeing that this would drive European and American farmers out of business (which wouldn't be the worst of all things either considering just how much the US and EU spend on them each year), this isn't gonna happen anytime soon.
-- "None" (2003-11-15)

[Mr. Nail Head, meet Mr. Hammer.]

Do unto others as they do unto you.
-- unknown

[Treat people according to their own standards.]

Never forget that the primary purpose of the news media is to sell advertising.
-- unknown

The majority of pacifists either belong to obscure religious sects or are simply humanitarians who object to taking life and prefer not to follow their thoughts beyond that point. But there is a minority of intellectual pacifists, whose real though unacknowledged motive appears to be hatred of western democracy and admiration for totalitarianism. Pacifist propaganda usually boils down to saying that one side is as bad as the other, but if one looks closely at the writing of the younger intellectual pacifists, one finds that they do not by any means express impartial disapproval but are directed almost entirely against Britain and the United States ...
-- George Orwell, Orwell's Notes on Nationalism (May 1945)

[Some things never change. The usual lefty-looney game is to treat the United States, the Taliban, Saddam Hussein, Kim Jong-Il, George Bush, etc. as being completely morally equivalent. They are all equally as bad. Kicking a terrorist's copy of the Koran is morally equivalent to cutting a journalist's head off. If you truly believe this, then you need to take a step back and ask yourself, "When did I lose my marbles?".]

Those who beat their swords into plowshares will plow for those who don't.
-- unknown

Did you ever notice that when Microsoft is talking about how open source will destroy the software industry, it says you can't make money off of something that is free, but when Microsoft is trying to persuade enterprises to not adopt open souce, it says it is not free and emphasizes how much you have to pay some company to support it?
-- codeboy @ Linux Today (2004-06-24)

[The major technical challenge with being a pathological liar is keeping all of your lies straight.]

"Kagan is more blunt: 'People worry a lot about how the Arab street is going to react,' he notes. 'Well, I see that the Arab street has gotten very, very quiet since we started blowing things up.'"
-- Jay Bookman @ Disinfopedia, Pax Americana

The telephone is a technological device that is, in the context of wooing women, only to be used to set up your next date. You should only spend five minutes max on that sucker and then get the hell off the line. Yes, guys, beware. Talking on the phone is dangerous. It's like juggling with nitro. One slip and the next thing you know, things are blowing up in your face. Never have an extended chat-fest on the phone with a girl you are courting. Or as my Cousin, Sal 'The Fish' Love would say, "The less she knows about you, the more she'll want you."
-- Doc Love, Translating Womanese Into English

[If a woman says to you, "I really enjoy talking to you and I am having fun getting to know you more, and I want to continue to get to know you more, but I want to take it slow and take my time. Do you understand what I am telling you?", the correct response is "So, what's his name?".]

Alexis de Tocqueville observed that it is easier for the world to accept a simple lie than a complex truth.
-- Peter H. Salus, Unix historian

[Microsoft vs. IBM]

Naturally the common people don't want war; neither in Russia, nor in England, nor in America, nor in Germany. That is understood. But after all, it is the leaders of the country who determine policy, and it is always a simple matter to drag the people along, whether it is a democracy, or a fascist dictatorship, or a parliament, or a communist dictatorship. Voice or no voice, the people can always be brought to the bidding of the leaders. That is easy. All you have to do is to tell them they are being attacked, and denounce the pacifists for lack of patriotism and exposing the country to a greater danger. It works the same in any country.
-- Hermann Goering @ the Nuremberg Trials (1945)

[Though I have to question the relative ease with different types of government.]

But then she came to the point. Not only had she 'known' the Iraq war would fail but she considered it essential that it did so because this would ensure that the 'evil' George W. Bush would no longer be running her country. Her editors back on the East Coast were giggling, she said, over what a disaster Iraq had turned out to be. "Lots of us talk about how awful it would be if this worked out." Startled by her candour, I asked whether thousands more dead Iraqis would be a good thing.

She nodded and mumbled something about Bush needing to go. By this logic, I ventured, another September 11 on, say, September 11 would be perfect for pushing up John Kerry's poll numbers. "Well, thats different--that would be Americans", she said, haltingly. "I guess I'm a bit of an isolationist." Thats one way of putting it.

The moral degeneracy of these sentiments didn't really hit me until later when I dined at the home of Abu Salah, a father of six who took over as the Daily Telegraph's chief driver in Baghdad when his predecessor was killed a year ago.

-- Toby Harnden @ The Daily Telegraph (2004), commenting on the 'moral superiority' of "an American magazine journalist of serious accomplishment and impeccable liberal credentials" (Anne Garrels?)

Why stop at that? Where Micro-Soft's original corporate home was is very intresting. The Sundowner Motel in Albuquerque. The Sundowner was a seedy little Motel that was widely used by drug dealers and Hookers for their business.

Microsoft was born in a Whore House! Dosen't that explain their Business ethics?
-- thales @ Slashdot (2004-05-17)

Killing is often necessery, and the tools and preparations and training for killing form a big part of military training. Sometimes killing happens inadvertently due to supidity, or carelessness or racism, or maybe because some private has been at that .50 cal awake for 3 days, under a degree of stress that someone from a pampered and priviliged existance has trouble comprehending.

Members of the military are merely a broad spectrum from the society they are drawn from, and there are many very clever, intelligent, funny, caring human beings in most militaries, all the way through to people who really are at the shallow end of the gene pool, are ethically and morally deficient, and easily suggestible. At the end of the day, regardless of their background, abilities, or motivation for joining, these people have given up some of their freedom and human rights, and an unlimited liability to their society, so people like you have the right to call them sick fucks, and sleep in a warm bed safe at night.

To the survivors of some of the places I and some of my fellow soldiers have been deployed to, when option a) was continuing to be collectively abused and repressed by violent thugs, and option b) was for soldiers to drive them away, clear the roads of landmines, and allow the NGOs to start rebuilding their country, the benefits were far more direct and tangible than inventing a cure for cancer.

The military is nothing but a tool for a government to use, and if you don't like how your government uses your military, and you have the luxury of living in some form of democracy, take a good hard look at yourself, and the government you elected.

Although there are pertubations, democratic countries generally get the quality of government they ask for.
-- AC @ Slashdot, non-US soldier for 16 years (2004-05-09)

Why should I care what an actor says about anything other than acting?
-- Brandybuck (2004?)

Two roads diverged in a wood, and I took the road less traveled by and they CANCELLED MY FRIKKIN' SHOW. I totally shoulda took the road that had all those people on it. Damn.
-- Joss Whedon (on Angel's cancellation)

How is prostitution all that different than what most people would call a date? I mean, to get some on a date you gotta buy drinks, dinner, movie, flowers, etc... whereas with a prostitute you just give her the money and she can buy herself dinner, drinks, flowers, etc... Either way it costs you X dollars to get laid. I guess society just approves of the barter system when it comes to sexual relations.
-- 1029 (2004-02-13)
[Actually, I tend to think that prostitutes prefer to use the money to buy Crack.]

look; gawk; talk; date; wine; unzip; strip; touch; finger; head; mount; fsck; more; yes; spray; umount; sleep; leave
-- unknown
[These are all Unix commands.]

It's free. It works. Duh!
-- Paul Nelson (2004), Riverdale High School (Oregon), describing the rationale for using Linux in the classroom.

Besides, it's a myth that timekeeping is what analog watches are for. They are worn as jewelry for men. It's a vain, metrosexual affectation to wear a gold watch. There's your real reason.
-- Golias (2004-02-04)

Really, I'm not out to destroy Microsoft. That will just be a completely unintentional side effect.
-- Linus Torvalds (2003-09-28)

There's a traditional definition of a shyster: a lawyer who, when the law is against him, pounds on the facts; when the facts are against him, pounds on the law; and when both the facts and the law are against him, pounds on the table.
-- Eben Moglen (2003-11-24)

Thanks, Gartner. That's the kind of hard-hitting, insightful business advice we need in this management-by-Ziff-Davis world. Maybe next month they can do a helpful piece on not paying a parking ticket until you've been issued one, and then only if it was issued by a real Dept. of Traffic officer, and not some homeless guy who wrote the citation on a napkin.
-- BigRedFish (2003-11-20) Gartner says that maybe you should avoid being defrauded by SCO.

As for not representing the millions of people out protesting -- the whims of the masses are easily swayed, and we elect leaders to do the right thing, even if it's unpopular. If the people ultimately decide that the leader was wrong, then they are replaced next elections. Thus, the long term interests of the people are protected, but the short-term mass foolishness is neutered.
-- dfenstrate (2003-02-27)

Don't be too proud of this technological terror you've constructed. The ability to Slashdot a web site is insignificant next to the power of the Google Cache.
-- unknown

But it is not necessarily wise to write off the skinny kid with the sling quite yet.
-- Michael Y. Park (2003-10-01), commenting on OpenOffice vs. Microsoft Office

CCITT: Crazy Committee Interested in Travel & Talk

One of the items that often gets ignored in Microsoft's thinking is this: They were a small company with many competitors and Operating Systems were many and varied and had their niche; MS has changed the world by the proliferation of its operating system(s) and made it part of the INFRASTRUCTURE on which society relies. Once you control the infrastructure, you can't behave like MS currently is behaving - or the people and Governments will look for alternatives. They changed the world, but unfortunately, they can't change themselves and herein lies the biggest of their problems.
-- Anonymous Coward (2003-09-13)

Pet Peeve #843287: SUV drivers that whine about the price of gas. You bought that overpriced penis extension--learn to live with the consequences.
-- grub (11606)

I never realised before... GARTNER backwards is RENTRAG. Couldn't have put it better myself.
-- Ulysses Poubelle (2003-09-11)

Both, TLS/1.0 is based on X.509 certificates which are painfully obscure and badly designed. ASN.1 is not for the faint-of-heart, and the whole 'ou', 'cn', 'dn' thing makes no sense to people who work in organizations of less than 500 people, doesn't fit the rest of the Internet, and was obviously designed by committee of technical bureaucrats.
-- Eric M. Hopper

A triumph of bloated theory over clean implementation.
-- Huw Rogers describing the Basic Encoding Rules of ASN.1

The UN gains its legitimacy from the legitimacy of its constituent states; they do not gain their legitimacy from the UN.
-- Bernard Jones (2003-08-15)

I just saw the first political spin on this mess. Bill Richardson, the Former Energy Secretary, was on CNN saying we have a "third world power grid". What he didn't say and the CNN sycophant wouldn't bring up is that while he was in office the Clinton administration turned down every request to build new or upgrade existing power stations. The theory of the grid is that when one part of the grid needs power it can be shunted from areas with excess capacity. Just as in California (who also refused to build new capacity) THERE IS NO EXCESS CAPACITY! When one part is at capacity, they all are. Quite frankly, we're a living in a tech world now. We need the power. Until we stop politically cowtowing to "eco-nuts", "consumer advocates", and other neo-luddites this is going to keep happening.
-- digrieze (2003-08-14)

Do not try to think outside the box. That's impossible. Instead, only try to realize the truth. There is no box.
-- unknown

Complaining that [Linux] doesn't work well with Windows is like ... oh, say, evaluating an early automobile and complaining that there's no place to hitch up a horse.
-- Daniel Dvorkin (2003-07-28)

I think it is very fair to say that the Internet would not be where it is in the United States without the strong support given it and related research areas by the vice president [Al Gore] in his current role and in his earlier role as senator.
--Vinton Cerf (Internet pioneer, TCP/IP co-designer), quoted by John Schwartz, The Washington Post, 1999-03-21
[The Republican party invented the lie that Gore claimed to have invented the Internet and the media were overjoyed to fan the flames. Gore appears to have coined the term "Information Superhighway" to emphasize not its technical architecture but the way that government should approach funding and developing it.]

Now I will tell you the answer to my question. It is this. The Party seeks power entirely for its own sake. We are not interested in the good of others; we are interested solely in power. Not wealth or luxury or long life or happiness: only power, pure power. What pure power means you will understand presently. We are different from all the oligarchies of the past, in that we know what we are doing. All the others, even those who resembled ourselves, were cowards and hypocrites. The German Nazis and the Russian Communists came very close to us in their methods, but they never had the courage to recognize their own motives. They pretended, perhaps they even believed, that they had seized power unwillingly and for a limited time, and that just round the corner there lay a paradise where human beings would be free and equal. We are not like that. We know that no one ever seizes power with the intention of relinquishing it. Power is not a means, it is an end. One does not establish a dictatorship in order to safeguard a revolution; one makes the revolution in order to establish the dictatorship. The object of persecution is persecution. The object of torture is torture. The object of power is power. Now do you begin to understand me?
-- Orwell's 1984, also Dept. of Homeland Security's mission statement

Where I work, there are several developers that are worried about their VB, Visual C++ Knowledge not being able to transfer well to GNU/Linux. They fail to see the fact that Microsoft is the one that made it to where their knowledge was Microsoft centric. They have each come to the conclusion that it is Linux developers fault for not having programming IDE's that meet the needs of "Today's IT Staff".
-- Scott Carr

You still don't get it. It's not about right. Not about wrong. It's about power.
-- BTVS

"The good news is that the world economy is not in recession. The bad news is that no one realises it."
-- Stephane Garelli, International Institute for Management Development

The needs of the many outweigh the needs of the guy who can't run fast.
-- Francis, _Malcolm In The Middle_

When all else fails, there's always delusion.
-- Conan O'Brien

The industry looks and sounds more like a police force than a cultural force.
-- Peter Goddard, The Toronto Star (2003-04-19) [describing the music industry]

I hope that the lesser nations fear Bush and Rumsfeld. I know that they put my safety first! I think you get their message loud and clear. We are practically omnipotent and you had better not piss us off. We can send powerful long range bombers from the heartland of America's fruited plain to bomb the hell out of terrorist regimes. The number one fear for governments around the globe should be that they will spawn terrorists that hurt Americans. If they do, the long arm of the United States will avenge the treachery.
-- Mark (2003-03-28) in a letter to Pravda, a Russian tabloid rag [expressing in a rather unsophisticated way that instead of Americans being paralyzed with fear that they might say or do something that raises the ire of Muslims or others, it should be the other way around]

Please bring on the war. We are ready. We have suffered long enough. We may l