Cynical (i.e., accurate) quotations about technology, politics, religion, and life. Citations are provided where available. I should point out that I am neither a liberal nor a conservative; I am a centrist and a pragmatist.
Typical thinking of the average brainwashed union member. I'll try to enlighten you a bit. Money is simply a means of exchange, it doesn't matter how much of it you have, just what you can buy with it. Our standard of living s based on what the economy produces aka productivity.
When unions exist and remove any kind of meritocracy from the equation we get lazy workers promoted and we decrease the productivity of our economy. In other words we direct too much resources to purchase said good or service.
What unions do is make us all poorer through higer taxes or higher prices. Why would someone start a business or be a doctor when they can just be a garbageman and get $70+ wages and benefits? When our society directs most of its resources towards garbagemen what is left to invest in R&D and new products that create jobs?
Unions simply redirect productive capital to an unproductive union and decrease the productivity of our economy and our standard of living as well. It's a protection racket just like Tony Sopprano would run.
— Cam MacKay (2009-06-23) @ Slashdot
if (IE) { do tons of fucked up shit } else { everybody else's predictable behavior }
— eldavojohn (2009-06-19) @ Slashdot
I had a cold. I stayed in bed and ate chocolate for a couple of days, and my cold went away. From this I learned that (a) chocolate is a cure for the common cold and (b) having a cold causes you to gain weight.
— SQL Error (2009-06-18) @ Slashdot
“The failure to act now will reverse the hard-earned racial and social progress for which the Rev. Martin Luther King and so many others died and sacrificed.”
Correction—That progress was hard-earned in 1964 and 1969. By 2009, it has been squandered by the black community itself. Bill Cosby is right. The problems which plague blacks in America today are not due to a lack of government assistance or lack of opportunity, but are the direct result of people failing to take responsibility for their own lives.
In the decades since Dr. King's tragic death, the Civil Rights Movement has evolved into a racket. Today it is nothing more than a foil for socialism, government reliance, and political gain instead of a beacon of freedom, self-reliance and fairness. We don't need another corrupt government bureaucracy to “help” us. We need to cast off the chains of government paternalism and start believing in ourselves.
— Jim (2009-06-17) @ CNN
[Hand-outs only create a cycle of dependency. The Asians and Irish, much hated when they arrived in America, never had the affirmative-action breaks the Africans have had. It's time for the social activists to face reality.]
— Prof. Freeman Dyson (2007-09-29) @ Salon.com
— rtc100 @ CBC
Thank you, Rationalization Man. You have saved the village!
— House, M.D.
But what is revealing is that Muslims have yet again killed
29 fellow Muslims. A statistic worth repeating is that since 1948
(establishment of Israel) 11 million Muslims have died in violence.
Of this only 35 thousand (.03%) have been killed as a direct result of
the conflict with Israel. The vast majority, 90% have been killed by
fellow Muslims. The idea that this violence would disappear if Israel
were to disappear tomorrow is nonsense. Until the wider Islamic community
and their leaders begin to take ownership of and responsibility for the
endemic resort to violence in the greater Islamic world this will continue.
— ducimus1 (2008-12-07) @ freedominion
Carlton ... Truly the place of higher education that puts the
“K” in quality.
— pacman13 (2008-12-02) @ CBC [Regarding the Carlton student council's sexist-racist position against
extremely sick young white boys.]
The best argument against democracy is a five-minute
conversation with the average voter.
— Winston Churchill
If there's one thing that these left-wing posts reveal, it's the near complete detachment from reality of your average arm-chair pundit on the left. I'm never sure if it's propaganda, or thoughtlessness, but it's certainly a sad testament to the state of political discourse in this country.
Once upon a time, the left used to have a singular devotion to the plight of working people and a firm grounding in reality. It supported union rights, worker's rights, job development and economic growth. Nowadays, all I hear from the left is an irresponsible radical environmentalist agenda and outright envy at the main engine of job growth for Canadian blue-collar workers (i.e, the oil sands). In other words, the left has gone from being the party of blue-collar workers to the party of accountants and lawyers—most of whom are far to savvy to vote for economically irresponsible policies anyways.
If you're wondering why you're losing so miserably in your political battles, it's not because your average working man is stupid—as most of you probably think when shooting from the non-pulpit of the internet with the tired platitudes of ideological prophets masquerading as pseudo-scientists—but it's because your arguments are divorced from reality. I don't care if American companies are developing the oil sands. They pay taxes in Canada and they hire Canadian workers. Why do I care if Exxon makes a billion dollars rather than Irving? Incidentally, you would need look no further than the 1980s to see the consequences of Canadian-led development. It put thousands of people out of work because this country does not have the capacity to develop these resources on its own. That's a little fact-checking with history that some of you might consider doing from time to time.
2 cents a liter reduction in Diesel is bad policy in a number of abstract “big ideas” senses, but it reduces the price of food on my table. If you can't see that people like me—i.e., working families—are going to take feeding their kids over some “save the world” grand-scheme that isn't going to work anyway, then I'm sorry to say that the Canadian left is dead. What we have instead is a new-age religion with its own prophets, irrational hopes, and intense hatreds. If you start hating people because they don't agree with you, then you're no different than any other ideological zealot. And you'll never win.
— GroundWorking (2008-09-10) @ CBC
Smart people can believe in and do very dumb things. Being smart
doesn't mean you have any common sense. When I was at UBC law school I
was surrounded by some of the most intelligent idiots in the country.
— BlawBlaw (2008-07-13) @ freedominion
All the best to them. They voted on OOXML without seeing it.
Now they'll determine how to maintain it without seeing it. Maybe ISO
should stand for Invisible Standards Organization? Maybe one of the
participants can let me know where can I submit my invisible defect report?
— Rob Weir @ Groklaw [The ISO OOXML fiasco continues.]
But notice that this will cause whites to become
underrepresented, since we'll have a disproportionate amount of Asians
taking the place of whites. So, I propose we include a second quota
system so that there are proportionally to the population as many whites
in college as Asians. If this means so many Asians that would be able
to enter college don't, so be it.
— alexgieg (2008-07-15) @ Slashdot
Not to mention how this applied to Jews, who were even more
despised, persecuted, deprived of their hard earned possessions, socially
barred etc., and still managed to overcome all of these obstacles without
any special governmental aid.
— alexgieg (2008-07-15) @ Slashdot
But some how most bloggers in Canada only see the world
through US-tinted glasses ... or more accurately anti-US. It is really
annoying how you allow your hatred to cloud your understanding, though
not surprising. The most hate-filled people I find are the first ones who
say they want peace, just on their terms and no one elses. The US looks
out for its interests, that is true. But for the US, the perfect country
is a stable one they can trade with, because their economy is based on free
market principles. They don't want to take over, they don't want to spread
an empire, they want countries to run free and open so they can make money
dealing with them. The US described in frequent CBC blogs does not exist.
You are talking about Russia and China. They make money off misery.
— Socrates21stC (2008-07-11) @ CBC
My god can beat up your god. Do you know his name?
Sure you do. He talks to you every day. You could not live a normal
life without him. You believe in him, whether you like it or not.
Unless you abandon him completely, you cannot deny he exists.
(continued)
— Richard Bamford (2001-08-31) @ Secular
Web
Here's the thing. America is a long-term plan for me.
I don't know where these people plan to be in 10 years, but I plan to
be here. This is, of course, the same argument heard around President
Clinton's veto of ANWR [Arctic National Wildlife Refuge] drilling in 1995.
Among other things, if we had started drilling ANWR then, oil would be
already flowing. At its peak, ANWR could supply 1.45 million barrels per
day, enough to tell Hugo Chavez and all his Venezuelan oil to shove it
(with a little change left over).
— Glenn Beck @ CNN
It is a certain fact that not all Muslims are terrorists,
but it is equally certain, and exceptionally painful, that almost all
terrorists are Muslims. We cannot clear our names unless we own up to
the shameful fact that terrorism has become an Islamic enterprise; an
almost exclusive monopoly, implemented by Muslim men and women.
— Abdel Rahman al-Rashed @ BBC
The same people in the west who oppose(d) Somalia, Afghanistan,
Iraq are the same ones who say why did we fail in Rwanda, Zimbabwe, Burma?
We fail because the anti-war, politically correct world movement is
incapable of finding solutions, just pointing out failures. They see
actions as oil lust, hidden agendas, imperialism, etc. and inaction as
racism, hidden agendas and double standards. When you base your entire
political belief on thinking everything the US and Bush does is wrong,
you miss the point on really understanding things. They made mistakes,
no doubt about it, but to think the intent was malicious, oil lust with
a disregard for human life is just lazy. Thinkers and doers need to take
back politics and marginalize the anti-everything west movement that spun
out of the 90's.
— Socrates21stC (2008-06-25) @ CBC
If you're looking for a wife, get out of the US. Our angry,
second-wave-feminist, crybaby boomer mothers raised our generation for men
to hate themselves and women to hate men. For no good reason. Find me a
man who says “women should stay home, barefoot and pregnant!“
or ”women make great secretaries, but that's about it.”
No. One. Thinks. That. But we all have to grovel and supplicate
to prove we're not one of those sexist straw men our mothers made up.
— kklein @ Slashdot
It starts with a kind of counterculture narcissism that
has steadily eroded “left-wing” politics in Canada. It has
exchanged solidarity for identity politics, and replaced internationalism
with cultural relativism. When you replace critical analysis with a
crude anti-Americanism, all that's left is the fashionable radicalism of
the liberal elites and the pseudo-leftism of the radical chic.
— Terry Glavin @ The
Vancouver Sun
I think you are right to a degree. I have read some of his stuff but quickly became irritated with him. His tone quickly became anyone who doesn't believe is stupid and they believe in nonsense. He made a large number of assertions that morality can only exist because of God, but he relies on a terribly flawed model to make his proof. He ignores the fact that humans by nature are herd/community animals and not loners. Humans tend to go quite insane without other humans around.
The greatest irony for me is that Jesus was VERY vocal about the whole Pharisee approach to the religion. He advocated the “love thy neighbor” and everything else falls into place naturally approach rather than the Pharisees and their “you must follow this monsterous list of rules and rituals” approach. Interestingly enough he also talks about how many of you will have claimed to know me and I will say I have never known you, get away from me. Even from the getgo he predicted that a large number of his “followers” would fall right back into that rules and rituals approach over kindness and compassion. He was ridiculed for spending so much time with the various sinners of his time and his answer was “A healthy man has no need for a doctor.” What is preached today in the name of Christianity is almost identical to the very same religious structure that Jesus fought against.
Dunno about the whole religious aspect of it all, but I think Jesus himself seems to be a pretty good example of how humans should behave. Which is why I think Jesus as a man is more impressive than Jesus as a divine instrument. As a man it means we should all be able to emulate that behavior. As a divine figure it gives the copout crap about how “he died for our sins, all you have to do is accept that”.
Either way my two most favorite things to mess with the overly religious is walking past them as the pass out their bibles, preach on the corner, or pray in public (all of which was specifically advised AGAINST by Jesus “pray alone in your room for when noone else can hear you pray God does”) and saying “Jesus was such a jew” and watching them get up in arms because they are so ignorant of their own faith. The other fun one is a similar exploit, when asked some variant of “Do you accept Jesus?!” I answer something to the effect of “I follow the teachings of Yeshua” and laugh as they blather on about how I must accept Jesus instead.
— db32 @ Slashdot
Most economic fallacies derive from the tendency to assume
that there is a fixed pie, that one party can gain only at the expense
of another.
— Milton Friedman
Amira; but it does fly in the face of their arguments that;
a) the war is not winnable, b) our presence drives ever increasing numbers
of Afghans into the Taliban camp, c) that all our boys have died in vain,
d) this is just a Western imperialist incursion into a stable and happy
Muslim country, and e) we are just America's lapdogs (along with the rest
of Western Europe). Now that levels of violence are down in both Iraq
and Afghanistan, the possibility becomes real that maybe both countries
can become strong enough to withstand attacks from their respective
insurgencies, and our soldiers can leave. Then we can help with schools
and bridges. But, wouldn't this suggest (gasp!) that the Bush doctrine
was in fact correct? Oh, the horror! And you know as well as I do that
there are significant numbers of Bush and America haters that would never,
ever, admit that. So yes, I do stand by my original comment that this
is bad news for some people; those who hate America, Bush, and democracy
so much that they do, in fact, desire these missions to fail as miserably
as possible.
— Mikethespike @ CBC
(2008-06-10)
This story reminds me of a Vancouver entreprenuer who had a
small business 25-30 years ago. He had a non-union labour staff that
he treated fairly and negotiated deals once a year that were agreed
to with a handshake. One day a union (can't remember which one but
it might have been CAW) came by and convinced the staff to unionize.
Since there was no written agreement the union convinced the workers
to strike and force the boss to negotiate a new deal. The first day of
pickets the boss didn't come in. After the pickets were gone at night,
the boss came in, stored and winterized all his equipment, locked all
the doors and gates and walked on a plane to Hawaii. The picket line
stayed up for weeks before they realized he was gone and months before
they realized he wasn't coming back. Priceless.
— Anthony @ CBC
(2008-06-10)
There's room on this earth for all of God's creatures.... Right
next to the mashed potatoes.
— ChadLaroche @ CBC
(2008-06-02)
They've just worked out that it's cheaper to push a few coders
into FOSS projects that are non-core but valuable to their business than
it is to pay the MS tax for eternity. Let's face it, computer users
have given Microsoft more than 150 billion dollars in the last decade.
If they had co-operated and contributed a small fraction of that to a
community project, they'd have saved money and got a lot better tool.
Plenty of other businesses are starting to come to the same conclusion.
— ozmanjusri @ Slashdot
(2008-05-30)
ISO: The best standards money can buy!
— (unknown)
Q: How many Microsoft employees does it take to change a light bulb?
A: None. They just change the standard to "Dark".
— (unknown)
Most people in the world understand that education [is
crucially important], whether it's how to hunt monkeys in the canopy,
or how to speak English to guide jungle tours. It's only in relatively
wealthy countries with enough infrastructure and social programs that
people can afford to stay stupid.
— lawpoop @ Slashdot
(2008-05-24)
“Question: Did Mr Einstein ever explain the exact origin of life? Just asking...”
and how exactly do the theists explain it? Adam had two sons... Where exactly did their wives come from?
— RichardFuoco @ CBC (2008-05-13)
I'm interested to know what everyone finds so great about
Battlestar Galactica. Is it the unpleasant personalities? The hopeless,
bleak despair? The overarching themes of predestination, lack of free
will and inevitable doom?
— EGN @ io9
(2008-01-04)
When goods cannot cross borders, armies will.
— Frédéric Bastiat (1801–1850)
[Protectionism is a failed ideology.]
I'm sorry one of your ancestors made a crappy deal a long
time ago. I had nothing to do with it and neither did you. You know,
my grandfather got a raw deal on a car back in 1979... he's dead now but
maybe I should go after that guy who ripped him off. With inflation I'm
sure I could get at least $2 Million.
— Brodie21 @ CBC
(2008-04-03) [Aboriginal land claims.]
The process was complete, utter, unadulterated bullshit.
— Tim Bray @ tbray.org
(2008-02-29), commenting on OOXML at ISO
Using a colloquial tone, professor Dawkins presents many
arguments against the God hypothesis. He has frequently been criticized
for writing a book on God while not being any kind of theologian; however,
he makes no apologies for it as his subject here is not “God
the theological construct” but “God the prime mover of the
universe”. Another way of putting it is that one doesn't need
a degree in “Unicornonology” to argue that unicorns, as a
biological species, do not exist.
— B. Leblanc @ Amazon
(2007-09-12)
Take the wind industry for instance. Throw a bunch of huge subsidies, tax breaks and easy carbon credits out there and you are going to attract the slimiest shysters imaginable.
No fossil fuel or nuclear plant on the planet has ever been displaced by wind power. In Germany, nearly 19,000 wind turbines cover the country, generating five per cent of its electricity. Yet 26 new coal plants are still planned, and six are on a fast track.
Emissions continue to grow, because the grid has to continue operating as if the wind is not blowing — because more often than not, they aren't generating electricity when there is an actual need.
The wind industry across the world has failed to demonstrate any savings in CO2 emissions at the end of the day. Denmark, the pioneer in the wind industry has actually increased it's CO2 emissions proportionally faster than other European Countries.
— M. Anderson, Ontario @ CBC (2008-03-11)
Ah, the final weapon of the creationists. If they can find any question, now matter how small, that doesn't have a rock-solid answer, then they loudly proclaim that “HA! YOU SEE?? YOU SEE?? NO ONE KNOWS FOR SURE!!” Any open questions means that every theory is equally valid. It's akin to saying, “Since the Earth's horizon makes it look like a flat disk, therefore, the flat-Earth theory is just as valid as the round-Earth theory.”
Well, every theory ISN'T equally valid. First of all, there is ZERO — ZERO — evidence against evolution. ZERO. There are certainly open questions about how certain things may have evolved, but that means there is a neutral question, not that it's “evidence against” evolution. So you have a Mount Everest of evidence for evolution, a large number of open questions (just the diversity of life and genetics means we're going to have a lot of open questions), zero evidence against evolution, and absolutely ZERO evidence that supports creationism. And, just to top it off, we have an entire planet-sized volume of evidence against the Earth being only 10,000 years old.
— Reality Master 101 @ Slashdot (2008-03-04)
[The argument is well-stated, though I don't like they way he conflates hypothses with theories. An hypothesis is an educated guess that one seeks to objectively validate. A theory is a set of hypotheses that have been overwhelmingly confirmed by and not contradicted by objective and concrete evidence, like the ‘theory’ of electromagnetism or the ‘theory’ of evolution. In the past, these would have been called laws of nature.]
I don't know about the rest of you, but I've had enough shovelling and chipping Global Warming off my driveway this winter.
— MRM @ CBC (2008-02-20)
“Your atheism has no basis in actual reality.”
Notwithstanding your rubber & glue counterargument, I would say that accepting objective reality as-is is the very definition of Atheism.
— Citizen of Earth @ Slashdot (2008-02-07)
The reason I point out the Church's sins, and that of most religions, is because it demonstrates rather well that whatever the particular claims of divine inspiration and guidance, religions are like all other human social constructs. There's no effective difference, either in governance or in command structure, between the Roman Catholic Church, China's Peoples Liberation Army or International Business Machines. The only meaningful difference is the leadership's particular claims as to the origins of their authority.
— MightyMartian @ Slashdot (2008-01-31)
Wait, am I suggesting that if I'd had broadband available, I'd've downloaded Windows? Point is, I would never download Vista, but that's mainly because of the incredibly effective antipiracy measures. Namely that it's shit and I don't want it.
— cream wobbly @ Slashdot (2008-01-31)
Yet today, there are few Biblical scholars — from liberal skeptics to conservative evangelicals — who believe that Matthew, Mark, Luke, and John actually wrote the Gospels. Nowhere do the writers of the texts identify themselves by name or claim unambiguously to have known or traveled with Jesus.
— Jeffery L. Sheler, “The Four Gospels”, (U.S. News & World Report, Dec. 10, 1990)
The world has been for a long time engaged in writing lives of Jesus... The library of such books has grown since then. But when we come to examine them, one startling fact confronts us: all of these books relate to a personage concerning whom there does not exist a single scrap of contemporary information — not one! By accepted tradition he was born in the reign of Augustus, the great literary age of the nation of which he was a subject. In the Augustan age historians flourished; poets, orators, critics and travelers abounded. Yet not one mentions the name of Jesus Christ, much less any incident in his life.
— Moncure D. Conway (1832–1907), Modern Thought
Of course we have seen it. It's all around us. It's in the fossil record. By your logic, nobody has actually seen galaxies evolve because they are looking into the past via the fossil record of the universe—radiation (light, X-rays, etc.)
Evolution can be easily traced back to the earliest creatures capable of leaving imprints of themselves behind. The entire process of developing lungs, limbs, spines, etc. etc. is all right there. Each step of the way. It is not a mystery. Just because it doesn't happen in a timespan and a place you personally can witness doesn't make it not so. The sun didn't form before your eyes did it? Did the mountains spring up so you could witness? Is geology a supposition? An educated guess?
You can demonstrate evolution in the lab with bacteria. You can demonstrate complex hydrocarbons doing all sorts of magical stuff in the lab (how life came to be in the first place.)
Tracing the biology of animals of this planet is a well known, well documented science. It is FACT, because the facts are right there in front of the entire worlds eyes, should they choose to look. Fish moving onto land, developing lungs, etc.
We have broken down the DNA code very well at this point, and can trace our origins that way as well. We can see where we differ and what we share with trees, worms, bacteria, dogs and elephants. Natural selection (the mechanism behind evolution) is everywhere as well. Look at dog and cat breeds. Cattle. Plants. Insects. You name it, you can change the creature itself by breeding.
Evolution is science. It is what the facts tell us. This is not a philosophical debate. There are no two sides. It is not a guess. It is about stupidity and blind faith. You can't reject evolution any more than you can reject combustion, or gravity. If people DO reject it, they are simply being ignorant and stupid. Plain and simple.
Basing "science" on something written thousands of years ago by people who were so far from us in their knowledge of the world is ridiculous. It is absurd. Why not simply observe the world? Observe what is right in front of our faces, and learn from it.
— Suicyco @ Slashdot (2008-01-11)
For all the philosophical rambling, none of them, absolutely none of them, escape this simple indisputable fact:
All religious teachings are provided to us by humans.
If God Himself appeared next to me and handed me a copy of the Bible, that would be one thing. But instead, a human handed it to me. And, in fact, a human wrote every word that is in it. This notion of “divine inspiration” (which is supposed to remove the element of human fallibility from the Bible) was communicated to me by ... wait for it ... A HUMAN.
— Anonymous Coward @Slashdot (2008-01-11)
Fight until there isn't a single non-muslim left, and Allah reigns supreme.
— Qur'an 8:39
Anyone leaving Redmond for the search leader is a threat. Not because they'll scurry around collecting company secrets — as if Google's interested in Microsoft's '90s-era technologies. Departing employees, however, might tell other 'Softies how much better Google is.
— Miguel de Icaza (2007-11-11) @Slashdot
Gentlemen and ladies. I hate inflation. I hate taxes and I hate Communism. Do something about it.
— Ronald Reagan, authorizing the end to 15 years of ‘stagflation’ and starting the longest and most powerful bull run in the history of the US stock markets @CTV
[Of course, the economically-illiterate will tell you that Reaganomics didn't work.]
I find it funny that the anarchist protesters out on the hill and at Montebello have a flag.
— Scott in Ottawa (2007-08-21) @CBC
[Perhaps it's because Anarchists are the first to admit that Anarchy doesn't work.]
Let's face it, the violence of the protesters is pure frustration at the public rejection of their bankrupt ideology.
Their inability to get even one like-minded MP elected anywhere in this huge country is indicative of their miniscule numbers and public support. Even the NDP won't touch them with a ten foot pole.
Throwing rocks is the only way to get any press coverage. "Look at me, I'm Che Gueverra!"
Ah, the blissful ignorance of youth.....
— Mike in Hamilton (2007-08-21) @CBC
It is always dissapointing to see Canadians who squander their
democratic rights and freedoms with pointless (and often destructive) bike
rides and protests. You leave Canadians like me with a sour taste in my
mouth and an unfortunate and contiunual reinforcement of my belief that
Canadians are spoiled brats who continually underestimate the complexity
of the world and the value of our relationship with the US (and Mexico).
— James in Ottawa (2007-08-20) @CBC
The protestors are mostly a collection of people who have re-labeled themselves as activists. In the past they were called malcontents. They usually are focused on a single issue, and rarely have any solutions to anything.
We protect their right to protest and speak their minds, but some of them have interpreted this as permission to incite violence, destroy property, and loot local business.
Gerry in Vancouver might ask himself if he would rather live under
an elected dictatorship, or a dictatorship led by unelected "activists".
Personally, I would go for the elected variety. At least I can get rid
of them the next election.
— Doug in Surrey, B.C. (2007-08-20) @CBC
How come God gets credit whenever something good happens?
Where was he when her heart *stopped*!?
— Gregory House, House, M.D. #3-24
Lots of people make the mistake of thinking that Microsoft is
a software company. That's wrong. Microsoft is an abuse company that
uses software as a method of delivering abuse.
— Futurepower(R) (2007-08-18) @Slashdot
No I am not worried. These things happen all the time.
The media has predicted 11 of the last 3 recessions.
— Chris in Alberta (2007-08-16) @CBC
Muslims kill Yazidis because they are not Muslim, yet people
blame the USA. Yep, that's logical!
— Joseph in London (2007-08-15) @BBC
On that basis, women marathon runners, who have been catching
up with men since the 1920s, were predicted to overtake men in the 1990s,
and presumably would be running beyond the speed of light if it were
continued for long enough.
[Arguing that past statistics give no indication of what might happen
in the future.]
— Dr. Helena Cronin @BBC
IIRC American Indians, many African cultures, and even our old agricultural society were much respectful of the environment.
Bullshit. The American indians simply lacked the technology to have a significant impact on their environment until they got horses, at which point their population expanded and they routinely exhausted hunting grounds, and became far more mobile as a result. As for African cultures, the majority of the Sahara desert became so because of goats, which were protected from predators by humans.
The fact is, it's the industrialized world that first became concerned
about the environment, because we're rich enough to have the luxury of
considering issues beyond subsistence.
— jcr (2007-08-05) @Slashdot
Is God willing to prevent evil, but not able?
Then he is not omnipotent.
Is he able, but not willing?
Then he is malevolent.
Is he both able and willing?
Then whence commeth evil?
Is he neither able nor willing?
Then why call him god?
— Epicurus (c. 341-271 B.C.)
They [Israel vs. Hezbollah] were trying to fight one of those "kinder, gentler wars". You know, kinda like what we do. First you drop leaflets warning everybody we're going to bomb. Then you allow 48 hours or so for the enemy to depart or dig in. Then you go in with munitions that won't just clear the earth and root out the tunnels and such. Then you send the troops and armor in after the enemy has returned or emerged from the tunnels and has target practice from their secure positions. It doesn't work well.
I suggest send the B-52's with all the bunker-buster weapons without
warning and make a wasteland of the enemy's positions. Oh, I know, I
know, some civilians are gonna take a hit. BUT, less troops will take
a hit when they go in with flame throwers and clear out any remaining
snipers and such. THERE IS NO SUBSTITUTE FOR VICTORY.
— JESTGETTINALONG (2007-06-14) @Drudge Retort
Hmmm... see I'm just not the type of guy to look at palestinians killing each other and say, "How is this my fault." The Palestinian people elected terrorists to lead them... there is no law that says we have to keep dumping buckets of cash on them, and if they're going to elect leaders that call for our's and an allies destruction we shouldn't give them money...
We are in no part to blame for this... the blame rests on the heads
of the Palestinians who loved and supported Hamas as long as they were
killing Jews... now they've turned on the Palestinians... good... fuck
'em all... they deserve it.
— Manypaths (2007-06-14) @Drudge Retort
Stephen Harper is so far up George Bush's ass that he can almost
see Tony Blair's feet.
— (unknown)
I'm not misogynistic; I hate whiny bitches of both sexes!
— EraseEraseMe @Slashdot
I think it was Smithsonian that ran an article about the impact
of cell phones in Africa and how it improved people's nutrition. It's long
been too expensive to run phone lines all across Africa. However, once
the mining companies starting throwing up cell towers, poor people got
a hold of used cell phones on their own. Now they are lining up buyers
for their crops in the field, instead of harvesting them, trotting them
all the way to market, and then letting them rot in the hot sun.
— lawpoop @Slashdot
Depends on what your definition of poverty is. Try telling
someone impoverished in India or China that most of the "poor" in America
are in poverty. Yes, capitalism creates large wealth difference. There's
no dirty secret there, that's pretty much the definition of capitalism.
But as the rich get richer, they drag the poor up with them. That's why
someone in the US who we call "poor" is still one of the most wealthy
and privileged human beings in the history of the world.
— bogjobber @Slashdot
Why are Libertarians insane? Because they willfully disregard
any evidence that their simplistic theories will not and do not work in
the real world. The free market is not magic and infallible. It is a
complex system of feedback loops that does not posses any sort of true
homeostasis and therefore needs external management in order to maintain
its state of freedom.
— spun @Slashdot
Judging from the media in recent months, the debate over
global warming is now over. There has been a net warming of the earth
over the last century and a half, and our greenhouse gas emissions
are contributing at some level. Both of these statements are almost
certainly true. What of it? Recently many people have said that the
earth is facing a crisis requiring urgent action. This statement has
nothing to do with science. There is no compelling evidence that the
warming trend we've seen will amount to anything close to catastrophe.
What most commentators—and many scientists—seem to miss is
that the only thing we can say with certainly about climate is that
it changes. The earth is always warming or cooling by as much as a
few tenths of a degree a year; periods of constant average temperatures
are rare. Looking back on the earth's climate history, it's apparent
that there's no such thing as an optimal temperature—a climate at
which everything is just right. The current alarm rests on the false
assumption not only that we live in a perfect world, temperaturewise,
but also that our warming forecasts for the year 2040 are somehow more
reliable than the weatherman's forecast for next week.
— Dr. Richard S. Lindzen, Newsweek
@msnbc
If you get to be thirty-five and your job still involves wearing
a name tag, you've probably made a serious vocational error.
— Dennis Miller
The conflict is between the West and small number of fanatics
who think they best way to publicise their racist, anti-Western views is
through the medium of indiscriminate mass murder. It does nobody except
these fanatics any good to pretend this is a clash of cultures.
[Substitute the term "cult" for "fanatics".]
— Jack, London @BBC
There is somebody right now watching, and God is speaking to
them about RRSPs. They've got RRSPs, and they've got a sizable amount,
and it's a security thing. Well, it's not a security thing; your security
is in God. And God's speaking to you to cash those in. And I dare you
to do it.
[Convincing proof that there is no God is that He doesn't strike down
His supposed ambassadors like this one. An RRSP (Registered Retirement
Savings Plan) is an income-tax shelter in Canada.]
— The Miracle
Channel in Canada fleecing its flock of their savings @CTV
First God made idiots. That was for practice. Then He made
school boards.
— Mark Twain
Evolution is about as much a theory as the theory of gravity.
But superstition has always guided most major facultative decision making in our times and previously. Witness everything from superstar athelets who run through seemingly bizzare rituals to assure victory, all the way up to "with the grace of God" or "Allah permits" suffixed to the most mundane.
Superstition rules. We make choices daily, big and small almost subconsciously driven by a clockmakers complexity of inner fears and hopes — all unsubstantiated but nevertheless more comforting that a cold reality.
Rational thought is too scary for a great many. As Dave points out above: “Stupid goddam smart people.”
That's the real issue.
The limited number of those who can accept the underpinnings of cold,
rational thought can't ever sway the majority who seek comfort in the
arms of an irrational belief that promises a reason for everything and
a benevolent purpose if one “toes the line”.
— Grendel (2007-01-30) @Drudge
Retort
But there's no denying Nader's impact. He invented consumer
watchdoggedness and helped wake up a dozing press so that it could become
what it is today: a force for general hostility against everything.
[Also includes a more fun quote: “Those who think Moore stands
for something will be disgusted to see him reversing course in 2004 with
a cry that voting for Nader is ‘Five minutes of feeling good [but]
you gotta pay for it the rest of your life.’ So: Moore actually
voted for his conscience before he was against it.”]
— Kyle Smith (2007-01-31) @NYPost
It is indeed a sorry situation. One thing that the US and UK
learned in Iraq is that there is a bubbling factional enmity among the
Arabs that coheres around religious tribal and clan loyalties over national
identities. As soon as the Israelis pulled out of Gaza the Palestinians
started fighting among themselves. I must say that the trend appears
increasingly intractable. Perhaps there is no solution —
The Arab countries seem to be so out of step with the rest of the World.
— Graham Lester, London (2007-01-27) @BBC
“One bright morning, in five or 10 years, perhaps during a regional crisis, perhaps out of the blue, a day or a year or five years after Iran's acquisition of the Bomb, the mullahs in Qom will convene in secret session, under a portrait of the steely-eyed Ayatollah Khomeini, and give President Mahmoud Ahmadinejad, by then in his second or third term, the go-ahead,” he wrote.
“With a country the size and shape of Israel (an elongated 20,000
sq km), probably four or five hits will suffice: No more Israel.”
— Israeli historian Benny Morris, quoted by BBC
You failed to do my job for me by protecting my child from
his/her own stupidity. Now you must make me rich.
— Anonymous Coward @Slashdot
In the land of the blind, the one-eyed man is usually crucified.
— El Torico
I am also sick and tired of the "Stalin card". Stalin was a magical thinker who had people killed for disagreeing with him, even about science. He also had fewer people straight up murdered than the christian Hitler (most of the millions counted as deaths on stalins head in communist russia starved as a result of his wholesale rejection of agricultural reality), and he invited the church back to Russia when it suited him.
Further, if atheism has to cop to every peasant who starved or died of disease or in prison in Russia and China, lets give Christianity every Native American who died of disease or starvation or in prison, and every European peasant who died as a result of bad economic planning or war or in prison. And lets be fair, and use population adjusted numbers.
The 30 years war alone killed 30% of the European population, the Great Famine between 10-25%. This happened in a christian culture and was worsened through poor management, so christianity gets the blame.
Disease alone killed perhaps 80% of the Native Americans, disease
brought by Christians, so again, blame christianity. Stalin and Mao
never even approached killing 80% of the populations of their countries!
[Dogmatic beliefs of any kind are equally dangerous, including the
dogmatic beliefs invariably held and practiced by genocidal dictators and
their henchmen. And complete faith in dogmatic beliefs is the definition
of religion. These dictatorships are merely lessons in religion run
amok.]
— jdaigle (2006-12-24)
@RichardDawkins.net
This is the concentration camp and crematorium at Auschwitz.
This is where people were turned into numbers. Into this pond were flushed
the ashes of some four million people. And that was not done by gas.
It was done by arrogance, it was done by dogma, it was done by ignorance.
When people believe that they have absolute knowledge, with no test in
reality, this is how they behave. This is what men do when they aspire
to the knowledge of gods.
— Jacob Bronowski, The Ascent Of Man
Again back to simplicity, the Christians have already
denied a Buddhist, Egyptian, Hindu, or animist god. Atheists (and [The
God Delusion]) just eliminate one more. The logic in that
is unassailable.
— Sailnsouth (2006-12-26)
@RichardDawkins.net
Some ideas are so stupid, only intellectuals would believe them.
— George Orwell
Atheism is a religion like not collecting stamps is a hobby.
— (unknown)
"My hands were shaking after reading this letter," said Kofi
Anan. "I mean, this is a REALLY harsh letter. I think North Korea will
disarm by the end of the year. My only concern is that it is too strong.
We only want North Korea to disarm. This letter might cause them to
surrender their entire country to France. The letter is really that
strongly worded. I'm shaking even now just thinking about it."
[Halt or I shall say "Halt" again!]
— Jerhad!com (2006-10-13) @Jerhad!com
It's not the lack of resources. It's the Stalinist tyranny and
socialist economic system. Only children, simpletons, and power-hungry
ideologues believe in socialism any more. It is the ideology of the ant
hill and the nursery school playground, unworthy of free men. It takes
no more intellectual sophistication to believe in collectivism than
to believe in Santa Claus, for the same reason and to the same effect.
Collectivism has caused more human misery than any other idea of the human
mind. With every vote I cast and every dollar I give to politicians, I am
guided by my desire to see it crushed and swept off the face of the earth.
[Communism is the longest and most painful path between Democracy
and Democracy.]
— ccmay (2006-10-23) @Slashdot
FUCK A PAPER TRAIL. We need PAPER ELECTIONS. Just that simple.
Can paper elections be rigged? Of course they can. Can they be rigged
as easily, as invisibly, as completely as digital elections? Hell no.
What's mind boggling is that there's even a debate here. Get rid of
digital voting machines. Hell, get rid of ANALOG voting machines.
Piece of paper, ink pen, padlocked metal box. That's how sane people
run elections. The notion of there being anything worth debating here
is nothing but complete bullshit.
[As a Doctor of Computer Science, I completely agree. All elections
are done on paper in Canada. And counting, even by hand, is a fully
parallelizable task.]
— Anonymous Coward (2006-10-21) @Slashdot
Lady, people aren't chocolates. But you know what they
are mostly? Bastards. Bastard coated bastards with bastard filling.
But I don't find them half as annoying as I find naive, bubble-headed
optimists who walk around vomiting sunshine.
— Anniee (2006-08-26)
Hitler was democratically elected. Does that mean that the rest
of the world should have financially supported his plans to develop Germany
out of post WWI poverty? Who in their right mind can support a group
vowed to genocide unless they approve of genocide? Yes, I feel sorry for
the Palestinians who are suffering. But democracy equals responsibility.
They thought Hamas would solve their problems; they were wrong. Now they
have the responsibility to find a solution.
[It's interesting how many people feel that Hamas is above reproach
since it was democratically elected and that Israel and the western
democracies are obligated to fund an organization dedicated to their
destruction. Here's the math: Democracy=Good. Terrorism=Bad. Terrorist
organization that was democratically elected into power=Still bad, plus
has apparatus of state to pursue its terrorist goals. The only thing
that being democractically elected with an overwhelming majority proves is
that the Palestinian voters definitely DESERVE to suffer the consequences
of their choice. Perhaps if the area wasn't so rife with corruption and
violence, unauthorized militias and terrorists, a legitimate political
party could actually be formed and the voters could have a better
choice than corrupt terrorist organization F vs. corrupt terrorist
organization H. But this is crazy talk. How could Palestinians ever
give up their self-defeating hatred and get on with their lives?]
— Mark Nelson, Tallinn, Estonia (2006-10-03) @BBC
Seems they can't exist unless they are fighting someone.
So, they hate Americans, they hate the Jews, and they hate each other.
Now tell me again, WHY should we be expected to fund this bunch of goons?
It is simply a welfare state that refuses to admit defeat. They live for
a protracted 'war' against the Jews; without it, they have no identity.
What a shameful existence.
— P McFall, Atlanta, US (2006-10-03) @BBC
Five years after the September 11 attacks, President Bush told the nation in his televised address, “If we do not defeat these enemies now, we will leave our children to face a Middle East overrun by terrorist states and radical dictators armed with nuclear weapons.” Whether right or wrong, President Bush did not tell us how we will defeat these unspecified and unnamed enemies, nor when.
In response to the president's address, Senate Minority Leader Harry
Reid said, “The American people deserved better last night. They
deserved a chance to reclaim that sense of unity, purpose and patriotism
that swept through our country five years ago.”
[Bush happens to be telling the truth here. Reid's criticism is that
Bush's comments were a downer rather than feel-good back-patting fest
and that Reid'd rather not think about such things.]
— Lou Dobbs (2006-09-13) @CNN
If the peoples of the Middle East continue on their present
path, the suicide bomber may become a metaphor for the whole region,
and there will be no escape from a downward spiral of hate and spite,
rage and self-pity, poverty and oppression.
— Historian Bernard Lewis, What Went
Wrong? (2002) @NPR
Early adopters aren't stupid
Oh, sure we're an impulsive crowd, but most are educated and realize when we've been snookered before.
Did nobody in either camp stop and look at how they had royally screwed every early adopter of HDTV? The promise of content that never occured. The delayed, and delayed, and delayed rollout of OTA. The jumble of formats that caused event the best CE to falter under the load of options. The incompatibilities between components. The ubiquitous component interface that every early adopter had on their display sets which are now utterly obsolete due to the need for “content protection”—a perfectly good $7000 50RP set which may be relegated to 480p at the whim of the broadcaster. The promise of 20Mb HD that got chopped into subchannels to rerun Andy Griffith and the Golden Girls in SD simultaneously, at the expense of HD. The iron fist approach to preventing transferring DVDs to Media Servers.
No, the industry has drawn a line, and the early adopters are on the other side. We're the ones who are most adversely affected by the content protection and market jockying. Don't come to me with your hand out for your improved shovel right after you run over my dog. The industry has, through their anti-piracy efforts, significantly alienated a large portion of their first-run consumers. They've managed to eliminate the initial cash infusion that covers the R&D part of the CE process, and now they're stuck with trying to add enough volume to get every household to buy the product just to cover the engineering costs.
The early adopters want to buy this stuff, but we want to
play with our new toys, not see how somebody else want us to
play with them. Give us back our control, and we'll open our wallets.
'Til then, go fuck yourselves.
[HD-DVD vs. Blu-Ray. Perhaps the manufacturers have already fucked
themselves.]
— Overzeetop (2006-09-01) @Slashdot
Jesus Christ, people, these are recent historical events. A matter in full view, and amply recorded by a variety of sources. This isn't like digging up old records of the Punic Wars or something, it happened just this fucking year.
They didn't launch an invasion on "the pretense" that you state. Since you seem to have missed it, Hezbollah *launched rockets* at a *city* in Israel, and then ambushed an IDF patrol with ATGMs, killing three soldiers and taking two prisoner.
That's not a minor little border skirmish like occasionally happened in Berlin during the Cold War. When you're *launching artillery rockets* at another nation's population centers, there's a word for that: war. When you do something of that sort, you're taking the gloves off. And I think everyone, from the pinkest neo-Marxist socialist feeb, to the most rabid big-L Libertarian nutbat, can agree that one of the *foremost responsibilities* of *any* government is to actually protect its citizens from attack, especially by NGOs firing free-flight artillery rockets from the other side of some line on a map. And *despite* that simple fact, Israel has put up with that kind of thing from Hezbollah for *years*, ever since it withdrew from Southern Lebanon in the first place.
To say this was a reaction to nothing more than the kidnapping of two soldiers is a grotesque and bald-faced mendaciousness on your part.
And even if that's *all* it was, Israel would still have been entirely
justified in going after Hezbollah. Nation-states get to do that kind
of thing when their citizens are attacked and kidnapped by foreign powers.
— Phanatic1a (2006-08-27) @Slashdot
I've been holding my nose and voting democrat for a long time
now merely because I think tax and spend is better than borrow
and spend.
— soft_guy (2006-08-24) @Slashdot
This is a statement of such historical ignorance it is utterly astonishing. If pacifists had had their way, Hitler would have had a damn site more than "a small corner of the world". British fighting spirit was not enough alone to keep the Nazi's out of UK. It took American armnaments - a steady stream of them starting well before the US entered the war. I hardly think that it's any more pacifist to send boatloads of tanks and ammunition to Britain than it is to send an armored division, do you? So if pacifism had ruled the day, there would have been no arms to Britain and the island would have fallen.
With Britain out of the picture and America still pacifist there's no Western front. The Soviet army managed to stop the German onslaught by a whisker. Given the complete attention of the Germany army, not to mention the finest German commanders like Rommel who would no longer be dueling the Brits in North Africa, the USSR would have fallen.
Is this your idea of a "small corner of the world"? At this point
Germany would have contolled everything form the UK to China to S. Africa.
And then why stop there? Why not invade S. America next? It's full of
resources, isn't it? What's to stop them? The only thing to stop them
would have been Japan, also seeking to expand it's empire. And guess
what - that means more violence.
[Pacifism is a policy that only looks good on paper.]
— theStorminMormon (2006-08-15) @Slashdot
Within a framework of civil decency, non-violent protests work.
But if the British had really wanted to use violence Ghandi would have
been dead with all his followers. His non-violent protests worked
in large part because it appealed to the better nature of his fellow
and Indians and also the British. Civil disobedience and other forms
of non-violent resistance require framework and leverage that simply
does not always exist, and in the end they put you in the mercy of the
person you're trying to resist. If that person really wants you dead,
then these tactics will fail miserably.
— theStorminMormon (2006-08-15) @Slashdot
[The other canonical case for Pacifism. It requires an *extremely* "sympathetic target" to have any effect other than your wholesale slaughter. Strangely, many liberals consider radical Islamic terrorists to be an ideal target.]
Karl Marx is to philosophy what Reverend Jim Jones is to religion.
— (unknown)
I do really love to see all of these Arab leaders begging for
C. Rice to come save them from Israel though. I notice she tends to wear
skirts to the meetings—really makes me happy!
— ILikeRed (2006-08-10) @Slashdot
Don't Cubans deserve the same the same human rights and freedoms
of speech as Castro's sycophants?
[BBC's Have Your Say is always an entertaining place. I was thinking
that maybe half of the message posters would be critical of the western
hemisphere's sole dictator, but it was only about 10%. Clearly, I had
underestimated the liberal-minded people's love affair with totalitarian
dictatorships. I guess they're great so long as you don't have to live
in one yourself. (No, I mean *actual* totalitarian dictatorships, not
what liberal types like to call America.)]
— Yvonne, New York City (2006-08-03) @BBC
[More BBC Have Your Say.]
I always wonder this. I mean, I belive there is a [God], but
I don't know for sure. I guess it's just what you want to believe.
Beliveving in the Lord has given me faith many times, and I feel like he
has helped me when I need it most. I know it could be my imagination,
but it makes me feel better to believe it. So I believe it.
[This person sums up the religious position of probably a lot of people.
I wish *I* had the power to choose what I believe. That would be extremely
convenient! Maybe this is the layman's superpower.]
— xbabibluangelx (2006-08-02) @IMDB
People have noticed [the UN Security Council's] failure to act
firmly and quickly during this crisis. I am deeply dismayed that my
earlier calls for the immediate cessation of hostilities were not heeded,
with the result that innocent life continues to be taken and innocent
civilians continue to suffer.
[I really can't see why Annan would be "deeply dismayed" by this.
Nobody takes the UN or Security Council seriously. I personally would be
flabbergasted if the Council ever did act quickly or firmly on anything
or if any side of a conflict ever took it serously. You'd think that
Annan would be used to being ignored.]
— Kofi Annan (2006-07-30) @CNN
Young women today are like superheroes in the first pages of
the comic book, blessed with incredible powers and not yet aware of
the responsibilities that come with them. Garbarino is no reactionary
preaching from the same book as the Concerned Women for America, and
his prescription for this cultural conundrum is not the kryptonite
of post-feminist retreat to the cotillion—and then the kitchen.
Anti-feminists were wrong, anyway. Freeing girls from stereotypes hasn't
made them more masculine; it's made them more more. Unbound from
cultural constraints, they don't flip to the male side of the spectrum.
They just flip out.
— Ana Marie Cox (2006-05-23) @Time
Muslim extremists kill our neighbours and murder our friends.
They march through our cities inciting religious hatred. They glorify
suicide bombing and attack the very freedoms our society is founded upon.
Then they expect us to be outraged when one of their militias comes
under attack. I'm sorry, but my sympathies are elsewhere.
[Goodness, can one possibly hope for a Muslim backlash against
terrorism?]
— Anthony Karas (2006-07-18) @BBC
Just imagine that the Mexicans lobbed missile after missile into
Texas and California. Would we just say, well, they are poor and oppressed
people? No, we would take the actions necessary to protect our citizens.
Consider the troubles in the UK, did the UK accept the IRA position,
or actively try to hunt them down and bring them to justice?
[My canonical example would be Cuba, considering that it is tiny, weak,
hostile, and perhaps crazy enough to try such a thing, considering that
Castro realizes he is not going to live forever and has been ratcheting
up his rhetoric lately. But, you still get a taste of the hypocrisy
of American pacifists. “Other first-world democracies should
absorb attack after attack from terrorists, but when anyone tries that
to us, WE KICK THEIR ASSES!”
The real reason that the Israeli-Arab conflict has lasted so long is
that the US has always restrained Israel from conquering its enemies.
And it will again, because some dangerously naive people have the bizarre
fantasy in their heads that there can be a negotiated peace with radical
terrorists. If we really believe such things, then we should let all
of our own psychotic serial killers back out onto the streets after they
agree not to kill any more people. And let them back out again and again
when they do.]
— Jack (2006-07-14) @BBC
“Israel in Lebanon—where will it end?”
It will end with the destruction of two ancient nations, Iran and
Syria. Future historians will say they were destroyed by Israeli nuclear
weapons but future philosophers will know they were really destroyed by
being consumed with their own hatred and intolerance.
— Mark (2006-07-14) @BBC
ACTTTTTCGCGAGAGGAGAGTGAGT//todo:this should only return
a positive values!AAAAAATTTCTATCTACTATCTACATATCATTACA/*warnin
g we are kluding around the antique "arthropod" module, here
there be bugs!*/AAAACTCTTATCTATTTATTCATCTATCATTCATCTATCATCT
ACTACTATCTAATCTATACA//haha nice hackACTCTACTATAGATCGATGT
[A fragment of human DNA, the source code of life.]
— ggvaidya (2006-05-18) @Slashdot
If I had wanted a lowest-common-denominator, unionized job, I would
have gone to trade school, become a machinist, and made auto parts for a
living. Oh wait — all those companies, that whole freaking
industry is going out of business in this country, because of the
way the Unions have driven the cost of production through the roof.
I hope they've had a good run, because they've collective-bargained
themselves out of a job.
[If I can't do my job better than anyone else available in the world,
then I don't deserve it.]
— Kadin2048 (2006-05-11) @Slashdot
"Pure racism! They don't want brown people to be treated like humans. Typical American behavior." — Howard Felton, London
So Howard, if I'm brown and break into your house, are you racist if
you ask me to leave?
[Illegal immigrants.]
— Erv Lawrence @BBC
I know when I am annoyed by something I'm more likely to resist.
For example, whenever I meet militant PETA people I really want to go
kill baby bunnies, skin them, and wear their bloody firs as a coat... and
I'm vegetarian!
— goofyheadedpunk @Slashdot
Remember, anyone can juggle for a second.
— John Alejandro King @covertcomic
It's dangerous to be right when the government is wrong.
Or at least it would be, if the government was ever wrong.
— John Alejandro King @covertcomic
Zacarias Moussaoui is a paranoid schizophrenic with delusional
beliefs, a defence psychologist told the trial of the convicted Sept. 11
conspirator.
[Come now, we can't accept this as a defence—because every
religious person can be described in exactly the same way. We can't let
them all walk.]
— CBC News (2006-04-18) @CBC
Easter and the concept of “Intelligent Delivery”:
On one side, there are the people who believe that the Easter Bunny delivers eggs and candies on Easter.
On the other side, there are those who say that there is no Easter Bunny. The eggs and candies are delivered/hidden by other humans.
If you want closed-mindedness, it exists on both sides of this issue.
Damn those Easter Bunny deniers and their closed minds! Damn those secular “Human Deliverers”.
You say that “Intelligent Delivery” is the “middle ground”. The existance of the Holy Hopper is not questioned. But he delivers the eggs and candies through his influencing human minds.
The Written Rabbit tells us only that He does deliver the eggs.
It does not say HOW he delivers them. Intelligent Delivery is the answer.
— khasim (2006-03-26) @Slashdot
If it's native tribes conducting the [harp seal] cull, then
it's a wonderful example of multicultural diversity. If white men do it
then they are evil bullies compensating for inadequacies elsewhere in
their lives. If white women do it then they are sassy and independent
and to be admired. I think that covers it.
— Mike Davies, Bury, UK (2006-03-23) @BBC
The California Condor is on the verge of extinction. It is
also very ugly. No one cares.
[OTOH, those baby seals are soooo cute.]
— [Mysturji], Basingstoke, UK (2006-03-23) @BBC
That's more a sign of the times really. A doctor now has to
think twice about helping after an accident: the victim might one day sue.
Another example of this sort of thing is lost children; if I see a lost
child I am staying the hell away and not helping them. Previously,
I'd speak to them and try to find a cop or store clerk that could help.
Now I'm just frightened of being accused of being a pervert or child
abductor. Your lost children are on their own, it's just not worth the
risk to help them anymore.
— glesga_kiss (2006-03-09) @Slashdot
Anthropic principle: We see the universe the way it is because
if it were different we would not be here to see it.
— proverb
Why do men earn more money than women? Because they deserve to.
[The facts that lefties don't want you to know. Continued:
“Men work longer hours at more dangerous and disagreeable jobs.
They more readily accept night shifts, hardship postings to Alaska and
entrepreneurial risks. Men get in-demand degrees in engineering, while
women get degrees in French literature. Female librarians earn less than
garbagemen, not because of discrimination, but because so many applicants
compete for the safe, clean, comfortable, convenient, fulfilling jobs women
prefer. Indeed, the author insists, statistics show that women and men
with equal experience and qualifications, doing the same job, for the same
hours, under the same conditions—get paid the same.”
It doesn't even make sense that women would get paid less for the
same work. In today's world of cut-throat business competition, if
a company could get the same quality of workforce by paying only 75%
as much—IT WOULD! Big-time!! Women would be
so outrageously in demand that it would cause their salaries to rise;
macroeconomic pressures are unavoidable. The guilty parties at keeping
women's salaries lower—are women. In aggregate, women simply
have different priorities from men, and this is not necessarily the Bad
Thing™ that Female Supremists would have you believe.]
— Reed Business Information @Amazon
Just one piece of advice about Love.... DON'T LISTEN TO ADVICE
ABOUT LOVE! :)
— Oliver, Paris (2006-02-14)
Doctor: Well, I'm afraid you have tuberculosis. I need
to know, are you a creationist?
Patient: What does that have to do with anything?
D: Well, I could give you the drugs that would cure Tuberculosis
as it was discovered in 1937, or the modern drugs that treat the disease
as it has evolved into today.
P: What's so great about the modern drugs?
D: They're intelligently designed...
— Doonesbury
“If our Muslim community wishes to boycott Danish products as an act of protest, the question is, why stop at Denmark? Why not start with American products?” the Congress said in a statement this week. “After all, it is the United States that occupies two Muslim countries, not Denmark.
“Where will this boycott stop? Will we stop buying French, German, Italian, Spanish and Norwegian products as well? After all, newspapers in these countries too have printed the cartoons.
“Many Muslim governments, led by dictators and kings, have fanned this selected sense of outrage against Danish food products. Their campaign reeks of hypocrisy and false bravado. After all, it is easy to give up on Danish cheese, but who will hand over their Microsoft products, their iMacs or their Mercedes cars. Not Hosni Mubarik, and definitely not King Abdullah or President Assad of Syria.”
The irony of this violence is that the most offensive of the cartoons shows prophet Muhammad with a bomb on his head — suggesting that Muslims are violent and aggressive. This was an opportunity for the Muslim community to disprove the stereotype by not retaliating with violence. But instead the extremists proved the cartoonists and editors right by taking violent protests to the streets, behaving completely irrationally, torching embassies, buildings and flags, and even causing the loss of life.
I asked Naser Khader why the extremists fell for the bait and why they encourage the conflict.
“Extremists can't live without enemies,” he says.
“They cannot live without conflict. When you don't have an enemy
or conflict, you can't get support and these guys can't exist without
it”.
[One note on language usage: in order for something to be
‘ironic,’ it must be unexpected.]
— Natasha Fatah
(2006-02-10), quoting the Muslim Canadian Congress @CBC
If you had been Danish, we'd kill you.
— some Lebanese protester to a Norwegian
journalist
Computer Science is the bastard child of Electrical Engineering
and Mathematics.
[Aww, and I thought I had coined that description, though I put
Mathematics first.]
— Albert Wong?
@UBC
Every time I hear someone say, “But it's only a theory,
not a fact” I cringe and then immediately ask them if they have
a problem with the Theory of Electromagnetism or the Theory of General
Relativity since they too are “just theories” and not facts.
The usual response is a blank stare as their mind tries to not assplode
from having to defend such a ridiculous statement.
[Bruce's Law: You can always count on laypeople to be too stupid to
understand what a scientific theory is.]
— smooth wombat (2006-02-08)
@Slashdot
> Are you serious or is the site just satire?
Nothing is just satire.
— intellectualwhores.com
Angela Dodson: I guess God has a plan for all of us.
John Constantine: God's a kid with an ant farm, lady. He's not
planning anything.
— Constantine (2005)
They say love should be unconditional. That's...stupid.
Love is too precious to be unconditional.
— Jason MacIsaac (2002),
Nice Guys Finish Last
Most people in the west know Islam by what we observe. We see
killers fly planes into buildings, take over schools, blow up, behead and
murder innocent people, including children. The killers commit these
crimes under the authority of a religion—Islam. A cartoon shows
Mohamed with a bomb in his turban. Muslims are mad at the wrong people.
The killers are now the image of Islam. If the killers are not the
true representatives of Islam, then Muslim furor should be directed at
the killers.
— Chuck Green, Dallas, Texas, USA (2006-02-02) @BBC
Now the “militants” are the militia of the
ruling party. They are one and the same with the Palestinian Authority.
If they bomb Israel from Gaza — not under occupation anymore, and is
therefore, technically, part of the Palestinian state the PLO proclaimed
in Algiers in 1988, but never bothered to take responsibility for —
that is an act of war, which can be responded to in kind, under
the full cover of the internationally recognized right of self-defense.
No more excuses that the Palestinians live under occupation, that the PA
is too weak to disarm Hamas, that violence is not the policy of the PA.
[Perhaps more has been gained than lost. Majority victory is not at
all what Hamas wanted. There is no more hiding behind the Palestinian
Authority when attacking Israel and no crying to mommy when Israel squishes
them like a grape in the war that Hamas starts.]
[Update July 2006: It didn't take long.]
— Emanuele Ottolenghi, National
Review (2006-01-26)
Generally, file systems are not considered “sexy.”
When a young programmer wants to do something really cool, his or her
first thought is generally not “Dude, two words... file
system.” However, I am what is politely termed
“different.”
[Even nerds have nerds.]
— Narayan Newton (2006-01-25),
Mad Pengiun
A theocratic country should not have nuclear technology.
— D Gorgerino, Paraguay
@BBC
I'm convinced that the universe has been created by someone
with a particularly vile sense of humor. I would like to propose a theory
of “intelligent malicious asshole design.”
— Antares
Actually, Microsoft has a lot of commercial interest in the Win32-platform (Windows-licenses, MSDN-subscriptions, courses, etc.) which is of course endangered by the Web.
That is why they wanted to establish their own network (MSN) with their own proprietary protocols and their own proprietary formats. They failed miserably and now MSN is just a normal ISP and uses Unix protocols and formats like anybody else. Microsoft did not “win” the Browser war; the whole Internet Explorer thing was damage control. After Netscape was dead, Microsoft was stuck with something they didn't really want. (An IE that was dominating but was running with open protocols and formats.) The better IE is, the more attractive the web becomes in comparison to Win32. So of course they let it rot, making IE better would have been counterproductive.
After Firefox started to destroy domination by becoming so big that
it can no longer be ignored (over 10% and rising is too much to ignore,
even if it's still a minority) therefore Microsoft fell back to damage
control mode.
— RoLi (2005-11-29) @Slashdot
It's one thing to say that a flu pandemic is inevitable.
But then, so are earthquakes, volcano eruptions, giant asteroids, and
the heat death of the universe....
— Tim (2005-11-13) @Slashdot
The children now love luxury; they have bad manners, contempt
for authority; they show disrespect for elders and love chatter in place of
exercise. Children are now tyrants, not the servants of their households.
They no longer rise when elders enter the room. They contradict their
parents, chatter before company, gobble up dainties at the table, cross
their legs, and tyrannize their teachers.
— Socrates (470 BC–399 BC)
I knew I'd hate COBOL the moment I saw they'd used
‘perform’ instead of ‘do’.
— attributed to Larry Wall
Organizations almost always try to skip steps in this process.
It's very tempting to do. They think to themselves, “No one would
buy version 1—it's too basic. Let's throw in at least a few version
3 features, and maybe a version 4 feature. That will make our product sexy
enough to sell.” But if you can't find anyone who needs version 1
of your product—desperately—you've built the wrong product,
and no amount of polish or number of added features will change that.
— Charlie Wood
@Moonwatcher
(2005-08-17)
What has gone wrong? Microsoft, with $40 billion in sales and
60,000 employees, has grown musclebound and bureaucratic. Some current and
former employees describe a stultifying world of 14-hour strategy sessions,
endless business reviews and a preoccupation with PowerPoint slides; of
laborious job evaluations, hundreds of e-mails a day and infighting among
divisions so fierce that it hobbles design and delays product releases.
In short, they describe precisely the behavior that humbled another tech
giant: IBM in the late 1980s. Tellingly, IBM reached a point of crisis
just over three decades after it started selling computers to commercial
users.
— Victoria Murphy @Forbes (2005-09-13)
Any sufficiently advanced incompetence is indistinguishable
from malice.
— AC @Slashdot (2005-09)
Perhaps we shouldn't rebuild on the lands that keep getting
destroyed... I hear that's what they did in the days before governmental
disaster relief.
— slughead @Slashdot (2005-09)
Given enough time and money, eventually Microsoft will re-invent
Unix.
[Or: "Windows is the longest and most painful path between Unix and
Unix.]
— (unknown)
The purpose of the office of the president is not to wield power,
but to draw attention away from it.
— Douglas Adams
Just because your idea of Philosophy is something to talk about
while you're smoking pot, doesn't mean that's all there is to it.
— SatanicPuppy @Slashdot
Technically, things may be going fantastically. It doesn't matter. The whole mission is about "Don't screw up! Don't screw up!" and every future mission will be "Don't screw up! Don't screw up!" until inevitably something does get screwed up. Every flight will consist of going into space to do the equivalent of refinishing a bathroom floor.
If NASA starts something new and ambitious with a clear, exciting goal
— the media and public will be able to accept risk the way they did
with Mercury, Apollo and the early shuttle program. But sending people
into space purely for the goal of not killing them? It's a dead end.
[The USA is no longer in the manned space-exploration business.
Man's only hope for getting off this rock lies with China now.]
— Otter @Slashdot
The IRA has shown itself to be completely untrustworthy in the past, and any declaration that it now makes needs to be viewed with scepticism.
Prior avowals of giving up violence as its method to achieve its aim have proven to be meaningless, with further murders occuring in less than a week of its declaration.
Gerry Adams of the Sinn Fein has long denied any ongoing membership in the IRA's directorate, yet one now reads that he has agreed to step down from the council that has been the command of the IRA.
A most wily politician, adept at double-talk that seldom ever clearly answers the questions asked, his obvious charisma and powers of persuasion have fooled the Americans and stymied the British for far too long. Previous promises to decommision arms have not come to fruition, with his declaring that such would be conducted in secret, with no accountability or outside witness to the fact.
He has claimed that his political party is a seperate entity to the IRA, does not control the army or shape and direct its future actions, but merely acts in an advisory capacity for the good of all Irish people in the quest to unite Ireland - against the will of the Ulster people - come what may.
It is surely obvious that the political wing and the armed wing are
joined at the hip, are the two parts of the whole - an entity that has
killed over 3000 people, the majority of whom were the native Irish
themselves. The present iteration of downing arms and ending murders
makes for good copy, but in reality who can trust the words of such a man,
when viewed in his historical perspective?
[Don't worry—the IRA are the *good* terrorists, the
*cuddly* mass murderers.]
— Jeremy Fuller
@CBC
For years, there was a widely held belief that Britain's
tolerance helped stave off any Islamic attacks at home. But the anger of
London's militant clerics turned on Britain after it offered unwavering
support for the American-led invasion of Iraq. On Thursday morning,
an attack long foreseen by worried counterterrorism officials became
a reality.
[Terrorists (and other criminals) always bite the hands that feed them.
This will happen to Canada, too.]
— Elaine Sciolino, et al. (2005-07-10) @NYT
We no longer stand on the shoulers of giants because we are
crippled by midgets.
[Mr. Art sees the innovation processing being hobbled by patents
and the first-to-file race. “There is a large amount of
huberis involved with the patent process that says 'no one is as smart
as me, so anyone who has a similar idea to mine must be stealing it'.
The problem is that when you have large numbers of people working on the
same problems, you are going to encounter the same solutions over and
over again.”]
— Black Art @Slashdot
Wow, I'm being shot at from both sides. That means I *must*
be right. :-)
— Larry Wall in
<199710211959.MAA18990@wall.org>
/* And you'll never guess what the dog had */
/* in its mouth... */
— Larry Wall in stab.c from the perl source
code
I am sick with this. What eBay are doing is profiteering on the
backs of the impoverished. The people who are selling it are wretches.
But far worse is the corporate culture which capitalizes on people's
misery.
[Don't look now, Bob, but you're guilty of exactly the same
thing. Funny how much riding room there is on the backs of the
impoverished.]
— Bob Geldof, on people selling
charity Live-8 concert tickets on eBay (2005-06-14) @BBC
Once again, the hungry, terrorised, children of Africa are
pooling their efforts to help others. They will, once more, perform on
our TV screens to help rescue the sagging reputations of that needy and
deprived group of balding, clapped-out rock stars who still long for the
crowds that once listened to them.
— Peter Hitchens in the Mail on Sunday
(2005-06-12), commenting on Bob Geldof's Live-8 concerts
There's really very little difference between radical
environmentalists and religious fundamentalists. Both want to control
what everyone else does and thinks based on their own unreasonable and
unprovable beliefs. “The end of the world is nigh” indeed.
— PaxTech @ Slashdot (2005-06-10)
As an African, I am full of anger knowing that my people have become mere pawns in this very cynical and self-serving antic of doing something for Africa—whatever this means. This is a game in which the real obstacles to our people's economic emancipation (i.e., African rulers) are gratuitously indulged at every opportunity, while our people become increasingly poorer.
I just wish that the Blairs and the Geldofs of this world would
stop exploiting my people's suffering in this way. It is, after all,
the case, that no impoverished African has ever asked anyone for aid.
If the Blairs and the Geldofs of this world cannot join us in demanding
responsible governance on our continent, I say, leave us alone; stop
prolonging our suffering with these antics. Enough is enough!
[Won't the bleeding hearts and artists be shocked to discover that
five years from now the people of Africa are just as poor as they were
today, thier despotic rulers are richer, and there are more wars being
fought on the continent and more acts of genocide being carried out.
Whatever will they do then? Hold another set of concerts, of course.
Donating money to dictators is an endless source of self-promotion.]
— UE, UK/Nigeria
(2005-06-06), about the Live-8 concerts @BBC
This is how liberty dies—with thunderous applause.
[I think George could have made his Dubya dig better by having Padmé
start with “So this is how democracy dies—”.
“Liberty” is too abstract a concept.]
— Senator Padmé Naberrie Amidala Skywalker,
Revenge of the Sith
Did you hear about the special edition of Raiders Of The
Lost Ark? The guy with the scimitar shoots first.
— nomadic
Fox exec Andy Setos told me that we were there to create “a
polite marketplace” where no one would be allowed to disrupt his
[digital television] business model without getting his permission and
cooperation first (*cough* planned economy *cough*
commies *cough*).
— Cory Doctorow on BoingBoing
We are all self-made, but only the rich will admit it.
— (unknown)
The most brilliant propagandist technique will yield no success
unless one fundamental principle is borne in mind constantly... it must
confine itself to a few points and repeat them over and over.
— Joseph Goebbels - Nazi Minister of Propaganda
People tend to overestimate change in the short term and
underestimate it in the long term.
— Robert X. Cringely (1997-06-12), apparently
quoting “Amara's Law”
Does the UN need an overhaul? Somebody has a sense of humour. It
needs scrapping. It serves no useful purpose and has failed at nearly
every opportunity when it could have done something. As it stands it
is a very expensive ‘talking shop’ and a stage for tin-pot
dictators and genocidal regimes to ‘strut their stuff’.
— John, France (2005-03-21)
“People are nervously asking themselves a question: Could [President Bush] possibly have been right? The short answer is yes,” wrote Fareed Zakaria, author of The Future of Freedom, in Newsweek magazine.
“Bush never accepted the view that Islamic terrorism had its roots in religion or culture or the Arab-Israeli conflict.
“Instead he veered toward the analysis that the region was
breeding terror because it had developed deep dysfunctions caused by
decades of repression and an almost total lack of political, economic
and social modernization,” Mr Zakaria wrote.
— BBC article
(2005-03-08)
Monogamy: Belief so strong that millions of people end perfectly
good relationships in order to start another.
— (unknown)
There are those who say, “Well, if you didn't go into
Iraq, there wouldn't be terrorists there.” They weren't some place
drinking tea and playing Scrabble. These are hardened Jihadists who will
fight us some place. And if they want to fight us in Iraq, where we are
140,000 strong, better there than in New York City again.
— Condoleezza Rice
I wonder.... Can Darl McBride drink a glass of water while
Maureen O'Gara speaks?
[Or, insert your favorite corporate con-artist/sycophant
“jouralist” pair.]
— roadfrisbee
@ Groklaw.net (2005-02-23)
Its easy to understand why the cat has eclipsed the dog as modern
America's favorite pet. People like pets to possess the same qualities
they do. Cats are irresponsible and recognize no authority, yet are
completely dependent on others for their material needs. Cats cannot be
made to do anything useful. Cats are mean for the fun of it.
— P.J. O'Rourke
Now, now my good man, this is no time for making enemies.
— Voltaire (1694-1778), on his deathbed in
response to a priest asking that he renounce Satan.
If God didn't exist, it would be necessary to invent him.
— Voltaire
Anyone who has the power to make you believe absurdities has
the power to make you commit injustices.
(*cough* priests *cough*!)
— Voltaire(?)
It is the final proof of God's omnipotence that he need not
exist in order to save us.
[And here I, as a mathematician, always believed that zero times
infinity is zero.]
— Peter De Vries
It only takes 20 years for a liberal to become a conservative
without changing a single idea.
— Robert Anton Wilson
Just goes to show that a great company with a great reputation,
skilled professionals, and a solid product line are no match for really
bad management.
— rip (2005-02-09), referring to CEO Carly
Fiorina stepping down from HP
The whole religious complexion of the modern world is due to the
absence from Jerusalem of a lunatic asylum.
— Havelock Ellis, 1914
So often underestimated, so often triumphant over his grovelling
critics. Take heed those who only live to complain and criticize.
He's at it again! God bless President Bush.
[I think that history will record Bush, Jr. as being a Reagan with
balls. Lefties love to stew in their hatred for the man, but what will
their excuses be when Bush prevails? What are their excuses for opposing
the man who busted the Soviet Union? “Aw, the Soviets weren't so
bad and living in the shadow of nuclear armageddon gave every day extra
zest.”?]
— Brian, Duluth, MN, USA (on BBC.com relative
to Bush's 2005 State of the Union Address)
Anyone who calls President Bush a liar does not understand the
times or the higher calling he made to all free nations to join in the war
on terrorism. Iraqis found WMD—“Western Made Democracy”
and they showed how much they are willing to sacrifice for it. Meanwhile
the IRA continues to dictate terms to the British government and bring
down the true wealth of the United Kingdom.
— Carlton, USA (2005-01-31), in the wake of
democratic elections in Iraq
Let every nation know whether it wishes us well, or ill, that
we shall pay any price, bear any burden, meet any hardship, support any
friend, oppose any foe to assure the survival and the success of liberty.
[A lefty who understood that totalitarian dictatorships are bad
news.]
— President John F. Kennedy
In Pierre Trudeau, Canada has finally produced a Prime Minister
worthy of assassination.
— John Diefenbaker
Religion is a by-product of fear. For much of human history, it
may have been a necessary evil, but why was it more evil than necessary?
Isn't killing people in the name of God a pretty good definition of
insanity?
— Arthur C. Clarke
Suppose we've chosen the wrong god. Every time we go to church
we're just making him madder and madder.
-- Homer Simpson
Doubt is not a pleasant condition, but certainty is absurd.
-- Voltaire
Yet, through it all, Sun was still partying like it was 1999. We all know that Sun's executives got the memo about many of its customers not wanting to buy servers that cost more than most luxury cars that are no faster and no more reliable than a typical Dell server. [...]
Sun doesn't have the mindshare of the next generation of unix/linux
gurus, those who learned on linux on their home PC, not in some computer
room on a donated sparcstation. And when you go from linux to Solaris,
you're in for a rude awakening. The default userland of Solaris is
still stuck in the early 80s for the most part, thanks to an adherence
to backwards compatibility that borders on fanaticism.
[Tell it like it is, brother! Amen.]
-- tots (2004-09-30)
"Setting Sun"
"... Because of the value that comes from the ambiguity of what
the U.S. may do to an adversary if the acts we seek to deter are carried
out, it hurts to portray ourselves as too fully rational and cool-headed
..." "The fact that some elements (of the U.S. government) may appear
to be potentially 'out of control' can be beneficial to creating and
reinforcing fears and doubts within the minds of an adversary's decision
makers ..." "That the U.S. may become irrational and vindictive if its
vital interests are attacked should be a part of the national persona we
project to all adversaries."
-- A CNN Report on a 1995 study "Essentials of
Post-Cold War Deterrence" by the USA Defense Department's Strategic
Command
The 1611 King James version, perhaps the most famous book
ever written by a committee, may reach poetic heights, but Alter says
it is fraught with "embarrassing inaccuracies" and often substitutes
Greek or Latin words and Renaissance English tonalities and rhythms for
biblical ones.
[Trouble brewing... If you were an indoctrinated fool, how would you
feel to discover that the King James bible is not the "Word of God" but
rather the word of a committee. Also, definitely do not do a web search
on the "Council of Nicea"... another committee, which formed the whole
of the religious canon of Christianity from selected letters written by
fanatical cult members over three hundred years before. Christ's divinity
was decided by a majority vote of the men present.]
-- CNN
(2004-11-18)
Without Arafat, the Palestinians would not have got as far
as they did. But with him, and because of him, they were unable to get
any further.
-- Ha'aretz, Israel (2004-11-12)
In the end, Yasser Arafat harmed the Palestinian cause...
His death now offers the Palestinians an opportunity to free themselves
from the autocratic and corrupt structures of an apparatus which has
become an end in itself.
-- Die Welt, Germany (2004-11-12)
Expecting that a new page will be opened by Arafat's death
means thinking that the only obstacle to peace was Arafat. How wrong...
Peace can only be possible by compromise on both sides.
-- Hurriyet, Turkey (2004-11-12)
Arafat has consistently thrown away chances for peace during
his leadership. He is an egocentric man who could have seen peace in his
lifetime had his own image been less important to him than what was best
for his people.
[Arafat: The man who never missed an opportunity to miss an
opportunity.]
-- Dan, Windsor, UK (2004-11-05)
Oxymoron of the Day: 'Democratic Imperialism'.
[We shall bludgeon them with freedom, maim them with rights, and
strangle them with prosperity. The streets shall flow with rivers of
self-determination!]
-- unknown
The purest form of joy in Islam is to kill and be killed
for Allah.
-- Iranian Ayatollah Khomeini
If most financial analysts watched a puppy growing for the
first month of its life, they would conclude that a year later it will
be 400-foot-tall monster trashing downtown Tokyo.
-- unknown
Right now, I'm devoting a great deal of time and study to that
problem. And I intend to issue a position paper on that. A position
that is at once simple, yet complex; firm, yet flexible; and above all,
fair to every American.
[Also, Senator Kerry's answer to most difficult questions
(2004-10-22).]
-- Les Nessman, WKRP in Cincinnati
When you're young, you look at television and think: There's
a conspiracy. The networks have conspired to dumb us down. But when
you get a little older, you realize that's not true. The networks are
in business to give people exactly what they want. That's a far more
depressing thought. Conspiracy is optimistic! You can shoot the bastards!
We can have a revolution! But the networks are really in business to
give people what they want. It's the truth.
-- Steve Jobs
A nation that coins the phrase "road rage" and watches reality
TV shouldn't be surprised when its elected officials are less than civil.
-- CNN (2004-10-15)
In 1972, Peter Gzowski, then summer host of This Country
in the Morning, held a contest to complete (in the manner of "As
American as apple pie") the saying "As Canadian as...". Heather Scott,
a seventeen-year-old summer music school student at the time, heard of
the contest, and immediately came up with the phrase that has since become
so famous. "As Canadian as... possible under the circumstances."
-- R. W. Scott, Heather's father (2004-05-18)
In Lebanon, some student members of the terrorist group
Hezbollah have asked if there was any way they could support the film.
Gianluca Chacra, the managing director of Front Row Entertainment, the
Middle East distributor for Fahrenheit 9/11, has stated, "We can't go
against these organizations, as they could strongly boycott the film in
Lebanon and Syria. Having the support of such an entity in Lebanon is
quite significant for that market and not at all controversial. I think
it's quite natural."
[Fahrenheit 9/11 -- Hezbollah approved! Here's hoping Michael Moore
makes hundreds of millions more in the Middle East by inspiring a new
generation of terrorists. He has no qualms about accepting blood money,
right? Green is green when you are a cynical, self-serving, narcissistic
and sleazy business man like Moore. Oh, and hypocritical, too.]
[Correction (2006-08-14): It looks like the new generation of terrorists
that Michael Moore & The Liberal Hysteria (catchy rock-band name?) have
inspired is the children of Islamic immigrants to first-world democracies.
The Mullahs thank the western media for reinforcing the idea that the
west is wicked and must be punished.]
-- Wikipedia
Fascists divide in two categories: the fascists and the
anti-fascists.
-- Ennio Flaiano
The prospect of technological leverage will of course raise the
specter of unemployment. I'm surprised people still worry about this.
After centuries of supposedly job-killing innovations, the number of jobs
is within ten percent of the number of people who want them. This can't
be a coincidence.
[If the doom-sayers were right, there would only be ten jobs in the
world today.]
-- Paul Graham (2004-09), What The Bubble Got Right
So when the announcement was made at a press conference in the UK
that Newham, a borough of London, had just decided not to go open source
after all and instead to sign on with Microsoft because their software
was cheaper than open source and more secure, the room spontaneously
burst out laughing.
[Tee-hee-hee. It's a sure sign that something is well-known when even
journalists get it.]
-- Pamela Jones, Groklaw
(2004-08-17)
The anti-globalization crowd is about the most hypocritic bunch of people without any clue about what they're talking ever (mostly liberal arts crowd without even the most basic understanding of economics and usually no need to have it anyhow cause their parents will pay for their life one way or another) I can think of. They'll hold global meetings claiming that other people who do the same have no right to do so (I'm not even going into discussing just how good PR it is to blow up cars and McDonalds stores). It's also most interesting that the people affected the most by globalization (low class, factory workers and the like) aren't nearly as vocal about it as the people who BENEFIT of it.
The only (proveable, BTW) way to get the 3rd world up to speed (aside
of pumping trillions of dollars down there which in the end would be spent
on weapons or trickle into some corrupt leaders pocket anyhow) would be
to drop all protectionist duty on agricultural goods, essentially kicking
*up* globalization a few notches, not trying to slow it down. But seeing
that this would drive European and American farmers out of business (which
wouldn't be the worst of all things either considering just how much the
US and EU spend on them each year), this isn't gonna happen anytime soon.
[Mr. Nail Head, meet Mr. Hammer.]
-- "None" (2003-11-15)
Do unto others as they do unto you.
[Treat people according to their own standards.]
-- unknown
Never forget that the primary purpose of the news media is to
sell advertising.
-- unknown
The majority of pacifists either belong to obscure religious
sects or are simply humanitarians who object to taking life and prefer
not to follow their thoughts beyond that point. But there is a minority of
intellectual pacifists, whose real though unacknowledged motive appears to
be hatred of western democracy and admiration for totalitarianism. Pacifist
propaganda usually boils down to saying that one side is as bad as the
other, but if one looks closely at the writing of the younger intellectual
pacifists, one finds that they do not by any means express impartial
disapproval but are directed almost entirely against Britain and the
United States ...
[Some things never change. The usual lefty-looney game is to treat
the United States, the Taliban, Saddam Hussein, Kim Jong-Il, George Bush,
etc. as being completely morally equivalent. They are all equally as bad.
Kicking a terrorist's copy of the Koran is morally equivalent to cutting
a journalist's head off. If you truly believe this, then you need to
take a step back and ask yourself, "When did I lose my marbles?".]
-- George Orwell, Orwell's Notes on Nationalism
(May 1945)
Those who beat their swords into plowshares will plow for those
who don't.
-- unknown
Did you ever notice that when Microsoft is talking about how
open source will destroy the software industry, it says you can't make
money off of something that is free, but when Microsoft is trying to
persuade enterprises to not adopt open souce, it says it is not free and
emphasizes how much you have to pay some company to support it?
[The major technical challenge with being a pathological liar is
keeping all of your lies straight.]
-- codeboy @ Linux Today (2004-06-24)
"Kagan is more blunt: 'People worry a lot about how the Arab
street is going to react,' he notes. 'Well, I see that the Arab street
has gotten very, very quiet since we started blowing things up.'"
-- Jay Bookman @ Disinfopedia, Pax
Americana
The telephone is a technological device that is, in the
context of wooing women, only to be used to set up your next date.
You should only spend five minutes max on that sucker and then get the
hell off the line. Yes, guys, beware. Talking on the phone is dangerous.
It's like juggling with nitro. One slip and the next thing you know,
things are blowing up in your face. Never have an extended chat-fest on
the phone with a girl you are courting. Or as my Cousin, Sal 'The Fish'
Love would say, "The less she knows about you, the more she'll want you."
[If a woman says to you, "I really enjoy talking to you and I am having
fun getting to know you more, and I want to continue to get to know you
more, but I want to take it slow and take my time. Do you understand what
I am telling you?", the correct response is "So, what's his name?".]
-- Doc Love, Translating
Womanese Into English
Alexis de Tocqueville observed that it is easier for the world
to accept a simple lie than a complex truth.
[Microsoft vs. IBM]
-- Peter H. Salus, Unix historian
Naturally the common people don't want war; neither in Russia,
nor in England, nor in America, nor in Germany. That is understood.
But after all, it is the leaders of the country who determine policy,
and it is always a simple matter to drag the people along, whether it is
a democracy, or a fascist dictatorship, or a parliament, or a communist
dictatorship. Voice or no voice, the people can always be brought to
the bidding of the leaders. That is easy. All you have to do is to
tell them they are being attacked, and denounce the pacifists for lack
of patriotism and exposing the country to a greater danger. It works
the same in any country.
[Though I have to question the relative ease with different types
of government.]
-- Hermann Goering @ the Nuremberg Trials (1945)
But then she came to the point. Not only had she 'known' the Iraq war would fail but she considered it essential that it did so because this would ensure that the 'evil' George W. Bush would no longer be running her country. Her editors back on the East Coast were giggling, she said, over what a disaster Iraq had turned out to be. "Lots of us talk about how awful it would be if this worked out." Startled by her candour, I asked whether thousands more dead Iraqis would be a good thing.
She nodded and mumbled something about Bush needing to go. By this logic, I ventured, another September 11 on, say, September 11 would be perfect for pushing up John Kerry's poll numbers. "Well, thats different--that would be Americans", she said, haltingly. "I guess I'm a bit of an isolationist." Thats one way of putting it.
The moral degeneracy of these sentiments didn't really hit me until later when I dined at the home of Abu Salah, a father of six who took over as the Daily Telegraph's chief driver in Baghdad when his predecessor was killed a year ago.
-- Toby Harnden @ The Daily Telegraph (2004), commenting on the 'moral superiority' of "an American magazine journalist of serious accomplishment and impeccable liberal credentials" (Anne Garrels?)
Why stop at that? Where Micro-Soft's original corporate home was is very intresting. The Sundowner Motel in Albuquerque. The Sundowner was a seedy little Motel that was widely used by drug dealers and Hookers for their business.
Microsoft was born in a Whore House! Dosen't that explain their
Business ethics?
-- thales @ Slashdot (2004-05-17)
Killing is often necessery, and the tools and preparations and training for killing form a big part of military training. Sometimes killing happens inadvertently due to supidity, or carelessness or racism, or maybe because some private has been at that .50 cal awake for 3 days, under a degree of stress that someone from a pampered and priviliged existance has trouble comprehending.
Members of the military are merely a broad spectrum from the society they are drawn from, and there are many very clever, intelligent, funny, caring human beings in most militaries, all the way through to people who really are at the shallow end of the gene pool, are ethically and morally deficient, and easily suggestible. At the end of the day, regardless of their background, abilities, or motivation for joining, these people have given up some of their freedom and human rights, and an unlimited liability to their society, so people like you have the right to call them sick fucks, and sleep in a warm bed safe at night.
To the survivors of some of the places I and some of my fellow soldiers have been deployed to, when option a) was continuing to be collectively abused and repressed by violent thugs, and option b) was for soldiers to drive them away, clear the roads of landmines, and allow the NGOs to start rebuilding their country, the benefits were far more direct and tangible than inventing a cure for cancer.
The military is nothing but a tool for a government to use, and if you don't like how your government uses your military, and you have the luxury of living in some form of democracy, take a good hard look at yourself, and the government you elected.
Although there are pertubations, democratic countries generally get
the quality of government they ask for.
-- AC @ Slashdot, non-US soldier for 16 years
(2004-05-09)
Why should I care what an actor says about anything other than acting?
-- Brandybuck (2004?)
Two roads diverged in a wood, and I took the road less traveled by
and they CANCELLED MY FRIKKIN' SHOW. I totally shoulda took the road
that had all those people on it. Damn.
-- Joss Whedon (on Angel's cancellation)
How is prostitution all that different than what most people would call
a date? I mean, to get some on a date you gotta buy drinks, dinner, movie,
flowers, etc... whereas with a prostitute you just give her the money and
she can buy herself dinner, drinks, flowers, etc... Either way it costs
you X dollars to get laid. I guess society just approves of the barter
system when it comes to sexual relations.
-- 1029 (2004-02-13)
[Actually, I tend to think that prostitutes prefer to use the money
to buy Crack.]
look; gawk; talk; date; wine; unzip; strip; touch; finger; head;
mount; fsck; more; yes; spray; umount; sleep; leave
-- unknown
[These are all Unix commands.]
It's free. It works. Duh!
-- Paul Nelson (2004), Riverdale High School (Oregon),
describing the rationale for using Linux in the classroom.
Besides, it's a myth that timekeeping is what analog watches are for.
They are worn as jewelry for men. It's a vain, metrosexual affectation
to wear a gold watch. There's your real reason.
-- Golias (2004-02-04)
Really, I'm not out to destroy Microsoft. That will just be a
completely unintentional side effect.
-- Linus Torvalds (2003-09-28)
There's a traditional definition of a shyster: a lawyer who, when the
law is against him, pounds on the facts; when the facts are against him,
pounds on the law; and when both the facts and the law are against him,
pounds on the table.
-- Eben Moglen (2003-11-24)
Thanks, Gartner. That's the kind of hard-hitting, insightful business
advice we need in this management-by-Ziff-Davis world. Maybe next month
they can do a helpful piece on not paying a parking ticket until you've
been issued one, and then only if it was issued by a real Dept. of Traffic
officer, and not some homeless guy who wrote the citation on a napkin.
-- BigRedFish (2003-11-20) Gartner says that maybe
you should avoid being defrauded by SCO.
As for not representing the millions of people out protesting -- the
whims of the masses are easily swayed, and we elect leaders to do the
right thing, even if it's unpopular. If the people ultimately decide
that the leader was wrong, then they are replaced next elections. Thus,
the long term interests of the people are protected, but the short-term
mass foolishness is neutered.
-- dfenstrate (2003-02-27)
Don't be too proud of this technological terror you've constructed.
The ability to Slashdot a web site is insignificant next to the power of
the Google Cache.
-- unknown
But it is not necessarily wise to write off the skinny kid with the
sling quite yet.
-- Michael Y. Park (2003-10-01), commenting on
OpenOffice vs. Microsoft Office
CCITT: Crazy Committee Interested in Travel & Talk
One of the items that often gets ignored in Microsoft's thinking is
this: They were a small company with many competitors and Operating
Systems were many and varied and had their niche; MS has changed the
world by the proliferation of its operating system(s) and made it part
of the INFRASTRUCTURE on which society relies. Once you control the
infrastructure, you can't behave like MS currently is behaving - or the
people and Governments will look for alternatives. They changed the
world, but unfortunately, they can't change themselves and herein lies
the biggest of their problems.
-- Anonymous Coward (2003-09-13)
Pet Peeve #843287: SUV drivers that whine about the price of gas.
You bought that overpriced penis extension--learn to live with the
consequences.
-- grub (11606)
I never realised before... GARTNER backwards is RENTRAG. Couldn't have
put it better myself.
-- Ulysses Poubelle (2003-09-11)
Both, TLS/1.0 is based on X.509 certificates which are painfully obscure
and badly designed. ASN.1 is not for the faint-of-heart, and the whole
'ou', 'cn', 'dn' thing makes no sense to people who work in organizations
of less than 500 people, doesn't fit the rest of the Internet, and was
obviously designed by committee of technical bureaucrats.
-- Eric M. Hopper
A triumph of bloated theory over clean implementation.
-- Huw Rogers describing the Basic Encoding Rules
of ASN.1
The UN gains its legitimacy from the legitimacy of its constituent
states; they do not gain their legitimacy from the UN.
-- Bernard Jones (2003-08-15)
I just saw the first political spin on this mess. Bill Richardson,
the Former Energy Secretary, was on CNN saying we have a "third world power
grid". What he didn't say and the CNN sycophant wouldn't bring up is that
while he was in office the Clinton administration turned down every request
to build new or upgrade existing power stations. The theory of the grid
is that when one part of the grid needs power it can be shunted from areas
with excess capacity. Just as in California (who also refused to build
new capacity) THERE IS NO EXCESS CAPACITY! When one part is at capacity,
they all are. Quite frankly, we're a living in a tech world now. We need
the power. Until we stop politically cowtowing to "eco-nuts", "consumer
advocates", and other neo-luddites this is going to keep happening.
-- digrieze (2003-08-14)
Do not try to think outside the box. That's impossible. Instead,
only try to realize the truth. There is no box.
-- unknown
Complaining that [Linux] doesn't work well with Windows is like ... oh,
say, evaluating an early automobile and complaining that there's no place
to hitch up a horse.
-- Daniel Dvorkin (2003-07-28)
I think it is very fair to say that the Internet would not be where it
is in the United States without the strong support given it and related
research areas by the vice president [Al Gore] in his current role and
in his earlier role as senator.
--Vinton Cerf (Internet pioneer, TCP/IP co-designer),
quoted by John Schwartz, The Washington Post, 1999-03-21
[The Republican party invented the lie that Gore claimed
to have invented the Internet and the media were overjoyed to fan the
flames. Gore appears to have coined the term "Information Superhighway"
to emphasize not its technical architecture but the way that government
should approach funding and developing it.]
Now I will tell you the answer to my question. It is this. The Party
seeks power entirely for its own sake. We are not interested in the good
of others; we are interested solely in power. Not wealth or luxury or long
life or happiness: only power, pure power. What pure power means you will
understand presently. We are different from all the oligarchies of the
past, in that we know what we are doing. All the others, even those who
resembled ourselves, were cowards and hypocrites. The German Nazis and
the Russian Communists came very close to us in their methods, but they
never had the courage to recognize their own motives. They pretended,
perhaps they even believed, that they had seized power unwillingly and for
a limited time, and that just round the corner there lay a paradise where
human beings would be free and equal. We are not like that. We know that
no one ever seizes power with the intention of relinquishing it. Power
is not a means, it is an end. One does not establish a dictatorship in
order to safeguard a revolution; one makes the revolution in order to
establish the dictatorship. The object of persecution is persecution.
The object of torture is torture. The object of power is power. Now do
you begin to understand me?
-- Orwell's 1984, also Dept. of Homeland
Security's mission statement
Where I work, there are several developers that are worried about their
VB, Visual C++ Knowledge not being able to transfer well to GNU/Linux.
They fail to see the fact that Microsoft is the one that made it to
where their knowledge was Microsoft centric. They have each come to the
conclusion that it is Linux developers fault for not having programming
IDE's that meet the needs of "Today's IT Staff".
-- Scott Carr
You still don't get it. It's not about right. Not about wrong.
It's about power.
-- BTVS
"The good news is that the world economy is not in recession. The bad
news is that no one realises it."
-- Stephane Garelli, International Institute for
Management Development
The needs of the many outweigh the needs of the guy who can't run fast.
-- Francis, _Malcolm In The Middle_
When all else fails, there's always delusion.
-- Conan O'Brien
The industry looks and sounds more like a police force than a cultural
force.
-- Peter Goddard, The
Toronto Star (2003-04-19) [describing the music industry]
I hope that the lesser nations fear Bush and Rumsfeld. I know that
they put my safety first! I think you get their message loud and clear.
We are practically omnipotent and you had better not piss us off. We can
send powerful long range bombers from the heartland of America's fruited
plain to bomb the hell out of terrorist regimes. The number one fear for
governments around the globe should be that they will spawn terrorists
that hurt Americans. If they do, the long arm of the United States will
avenge the treachery.
-- Mark
(2003-03-28) in a letter to Pravda, a Russian tabloid rag [expressing
in a rather unsophisticated way that instead of Americans being paralyzed
with fear that they might say or do something that raises the ire of
Muslims or others, it should be the other way around]
Please bring on the war. We are ready. We have suffered long enough.
We may lose our lives but some of us will survive and for our children's
sake please, please end our misery.
-- Ken Joseph,
Jr. (2003-04-01) [paraphrasing the message of the people of
Baghdad]
Besides, we're the big bad Yanks--what kind of message would we be
sending to the world if we didn't do something... we huffed and we puffed
and now we're blowing the damn door down.
-- AC, Slashdot (2003-04-05)
How soon we forget! There can be no doubt that the USA saved the free
world in WW2 and preserved it by winning the cold war thereafter - both
at great cost to itself. We are bound to make mistakes in preserving
our way of life, but pandering to a creed that will always implacably
hate us should not include allowing them to acquire deadly weapons that
they would use against us without a moment's thought.
-- Andrew Day, London, UK (2003-04-02)
I am completely exasperated. Our comfortable democracies in the West
have bred a nation of naive, idealistic fools.
-- Wayne Mitchinson (2003-04-02)
"Peace" in Iraq has left 2-million civilians dead. Give war a chance.
-- unknown (2003-03-28)
Protectionism only serves to kill those it seeks to protect.
-- ShadowMind (2003-03-28)
Code first, then specify. Anticipatory specs for problems people
haven't tried to solve yet are just wild, random shots in the dark;
at best, they waste everyone's time, and at worst, they cause confusion
and hostility.
-- PaulT (2003-03-08)
I know that Gnu's Not Unix. Now I guess that Linux Is Not UniX, too.
-- catclub (2003-03-07)
It's a fairly end-of-life move for the stockholders and managers of
that company. Really what beat SCO is not any problem with what IBM did;
it's what the market decided. This is a way of salvaging value out of
the SCO franchise they can't get by winning in the marketplace.
-- Jonathan Eunice, an Illuminata analyst
Question: How many activists does it take to change a lightbulb?
Answer: None. Activists don't change anything.
-- unknown
Remember - if you're sitting at a poker table and you don't know who
the sucker is, it's you.
-- unknown
Hubris is so cute.
-- Joss Whedon (2001)
This is the last chance for the U.N. to comply with its own resolutions.
-- unknown (circa Jan. 2003)
Obviously the UN is utterly useless against Saddam. Even when the
Iraqis admitted not complying with UN resolutions, nothing was done except
the passage of another meaningless resolution. Such hypocrisy by the
UN over enforcing their own resolutions is a travesty and proves they
have no credibility whatsoever in dealing with a ruthless and conniving
dictator like Saddam Hussein. The UN is a mere tool that Saddam uses
to keep himself in power, and has been exploited yet again. The UN is
nothing but a diplomatic obstacle to the one body willing to uphold the
UN's own ideals -- the United States of America.
-- Jeff Cullers
(2002-11-25)
We never see these grotesque realities on US television, and yet our
news media has not been shy about reporting the effects of US bombing
campaigns, never missed a chance to show us the weeping civilians wailing
over children lost in US air attacks, never blanched at showing charred
Iraqi soldiers hanging out of tanks destroyed by our weapons.
-- Proteus (2003-01-26)
No democracy has ever declared war on another.
-- Proteus (2003-01-26) [well, the War of 1812 comes
to mind]
A hero is a coward who has been cornered.
-- unknown
If you pick up a starving dog and make him prosperous, he will not
bite you. This is the principal difference between a man and a dog.
-- Mark Twain
99 percent of lawyers give the rest a bad name.
-- unknown
Eagles may soar, but weasels don't get sucked into jet engines.
-- unknown
The hardness of the butter is directly proportional to the softness
of the bread.
-- unknown
To succeed in politics, it is often necessary to rise above your
principles.
-- unknown
A clear conscience is usually the sign of a bad memory.
-- unknown
Or Canada! Our house and earth of the native one! The patriot's true
love in the whole order of thy children.
-- GlobaLink's Power Translator
O Canada! Our ground at the house and native! The true love of patriot
in all the wire thy order.
-- Babelfish (2005)
I think the recording industry as a whole has become a bunch of
parasites, and (worse) parasites that are killing the host.
-- sakeneko (2003-01-23)
The Free Market is why American flags are made in China instead of
Singapore.
-- unknown
In Socialist Europe, government owns companies. In Capitalist America,
COMPANIES own GOVERNMENT!
-- Rolo Tomasi (2002-12-12) [Pick your poison...]
That Joan of Arc is one *tasty piece of bitch*.
-- Joan of Arc as "John Dark", _Clone High_
The only thing that Australia has gained from Microsoft is an enlarged
sphincter.
-- Tony O'Bryan (2002-11-20)
This isn't even a slap on the wrist; it's a wink and a nod.
-- David (2002-11-01), commenting on the MS-DOJ
settlement
Monopolies are to capitalism as cancer is to an organism.
-- Evil Pete (2002-11-01)
Dot Com companies think 'Oh yeah, Dot Com, New Business Model, We're
Invincible!'. No No No, ladies and gentlemen. Warning warning, danger
danger! There is NO New Business Model.
-- Larry Smith, ECON101, 2000
Every big computing disaster has come from taking too many ideas and
putting them in one place.
-- Gordon Bell
Solaris: It may be slow, but it's hard to use.
-- adapted from a Unix fortune(?)
Their intent is to cause terror, to intimidate others into not
exercising their rights, and to fundementally alter (or destroy) the way
of life of others.
-- jedidiah, describing the MPAA, not al Queda
(2002-08-20)
History is littered with cases of inaction that led to have grave
consequences for the world.
-- US National Security Adviser Condoleezza Rice
(2002-08-15)
"Micros**t"
-- Ranjan SenGupta
Program testing can at best show the presence of errors, but never
their absence.
-- Edsger W. Dijkstra
The price of reliability is the pursuit of simplicity. It is a price
which the very rich find very hard to pay.
-- Sir Anthony Hoare (1980)
Computer science is as much about computers as astronomy is about
telescopes.
-- Edsger W. Dijkstra
What's going to win out in the long run is either no DRM at all or
devices that anybody can author to; there won't be any need to imitate
Microsoft's or anybody else's signatures. That, or people will just go
back to small, live performances. In any case, the big media companies
pushing for this are going to lose out. They had a golden era with vinyl
and CDs, where they could mass-produce cheaply but consumers couldn't
replicate, and there was no alternative or competition. That's over now.
-- g4dget (2002-07-29)
In the world of "everything is possible", nothing gets done!
-- Edric Keighan (2002-07-17)
I don't think we should focus on refactoring the Internet this month...
-- Jerome Sonnet (2002-07-09)
"Software sucks because users demand it to."
-- Nathan Myhrvold (former CTO of Microsoft) [I think
he's right]
If you wish strongly enough for something to be true, eventually your
logic will warp itself enough to make it true.
-- ac (2002-05-31)
When I hear of a long time smoker dying of lung cancer I think "That's
too bad, but they made their choices". When I hear about companies
gettings screwed by Microsoft, I think the same thing.
-- GNUTroll (2002-05-01)
"copying is piracy."
So 18th century pirates just boarded your ship, copied everything,
and left?
-- Anonymous Coward on Slashdot.org (2002-04-29)
The BSA is nothing more than a legalized protection racket.
-- chill (2002-04-29)
There has grown up in the minds of certain groups in this country the
notion that because a man or corporation has made a profit out of the
public for a number of years, the government and the courts are charged
with the duty of guaranteeing such profit in the future, even in the face
of changing circumstances and contrary to public interest. This strange
doctrine is not supported by statute or common law. Neither individuals
nor corporations have any right to come into court and ask that the clock
of history be stopped, or turned back.
-- Robert Heinlein
All you have to do is read the testimony coming from Dell, Gateway
and others before you understand that Microsoft will continue to use all
of the illegal means it can to preclude any technology it does not own.
When Microsoft is required to comply with the law, the market will change.
-- Lewis A. Mettler (2002-03-30)
NT is a weak form of unix like a donut is a weak form of a particle
accelerator.
-- MBCook (2002-03-23)
Yet the fact that they can leverage their monoplolistic stronghold in
their own antitrust trial is amazing!
-- OctaneZ (2002-03-05)
Microsoft, you sure are making it easy to break up with you...
-- scoove (2002-03-04)
Sure, other file-trading software has taken Napster's place, but at
this point it's fun just to watch the industry limp around after shooting
itself in the foot.
-- SF Gate & jamie@Slashdot.org (2002-02-27)
If an Afghan village is bombed and CNN is not there to film it, did
it really happen?
-- Mike Hynek (2002-01-18)
In the long run, a distinct society is likely to be more viable in
an economically vibrant Quebec, one unburdened by odd linguistic laws
and severe taxation, than in a Quebec that is dying a slow death, as
its citizens vote one at a time with their feet and their wallets. ...
While the diaspora [out-migration] may have begun with anglophones leaving
in the wake of separatist gains, their loss has so hurt the province
that francophones now leave in order to find better economic conditions,
both in the US and in other parts of Canada.
-- Matthew Stevenson (2000-10)
Whenever you find yourself on the side of the majority, it's time to
pause and reflect.
-- Mark Twain (1835-1910)
In an Internet without doors or walls, who needs Windows or Gates?
-- unknown
The whole problem with the world is that fools and fanatics are always
so certain of themselves, and wiser people so full of doubts.
-- Bertrand Russell
'Independence' is just an euphemism for having no friends.
-- Ben (Zurich [Switzerland])
A few months ago a friend of mine, a staunch Microsoft
supporter, converted his entire collection of MP3's (about 150 CDs;
he'd ripped his whole library) to WMA format. The quality was fine, the
files were smaller, and off he toddled. A few weeks later he upgraded
his operating system, and WMA's Rights Management kicked in and told
him he couldn't play any of those files anymore. Ouch! Weeks later,
he'd re-ripped his collection to MP3 and ripped a friend's as well.
Needless to say, he's not as staunch a supporter as he once was.
-- Tsar
Halting problem, Schmalting problem!
-- Glenn Stowe & Craig Bruce (refering to the
general web-services fantasy that syntax == semantics; wake up, people --
WSDL is worthless)
The XBOX represents the only true way you can DIRECTLY damage microsoft
through buying things.. Every unit they sell is sold at a loss..
Buy one.. Hack the hardware.. Make it do stuff its not supposed to do..
And don't buy any software for it :)
-- Lord_Pall
It is dangerous to be right when the government is wrong.
-- Voltaire
Anything that is too stupid to be spoken is sung.
-- Voltaire
Poor, poor OJ. He's only been able to convince 12 people in the whole
world that he's not a murderer.
-- Wil Wheaton
An armed man is a citizen. An unarmed man is a subject.
-- Heinlein
In other words, the only way to prevent corporate exploitation is to
get a consensus that such a thing exists. There is no such consensus
because it doesn't seem to bother those who are exploited, and the
exploitation is purely voluntary in nature. The people that seem to be
really bothered are the whiny protestors who go around destroying public
and private property and then don't seem to understand why they are more
hated than the corporations they are protesting against.
-- Fnkmaster (2001-11-01)
"No one will thank us for creating another syntax to learn."
-- Ron Lake (2001-10-25)
GPL Business Model --
Step 1) Release Free Software
Step 2) ???
Step 3) PROFIT!!
-- unknown (after Dilbert cartoon)
"The Misinformation Superhighway."
-- Greta Van Susteren, CNN (2001-10-19)
When AOL moves 20 million clueless idiots from MSIE to Gecko, Web
designers will fix the problems very quickly, making the Web a better
place for all of us.
-- Phroggy (2001-10-19) [Sadly, never to be.]
Thus continueth the cycle:
1. A few people pirate software/music.
2. Corporations get pissed at piracy.
3. Corporation spends millions on development of an anti-piracy scheme.
4. Corporation has to raise prices to compensate.
5. Scheme gets cracked within DAYS of release.
6. More people pirate because prices are higher.
7. Goto 1.
-- Desco (2001-10-19)
Free beer tends to lead to free speech.
-- unknown
Let's face it. They weren't baking cookies in those caves.
-- U.S. Defense Secretary Donald Rumsfeld
(2001-10-18)
Lou clapped his hands sharply for attention. He looked at us for a long moment. "Never forget," he said softly, "how easy it was for one man to make you do that."
I never will.
-- bill.sheehan
Audiophiles are people who listen to the audio equipment, not the music.
-- unknown
"Full power to the Heisenberg Compensators, Mr. La Forge!"
-- Craig Bruce
WAP is the OSI of this decade.
-- dublin
All those in favor of losing their rights, please do nothing.
-- merlin_jim
Bad People Use the Internet for Stuff.
-- someone on keepersoflists.org
The death of one man is a tragedy; the death of a million is a
statistic.
-- Joseph Stalin
In 2006 or so, someone is going to submit to Slashdot about the 10th
anniversary of Microsoft inventing the browser.
-- geophile (2001-09-05)
Mathematics, rightly viewed, possesses not only truth but supreme
beauty, a beauty cold and austere like that of sculpture.
-- Alan Turing
Without Turing, I'd either be out of a job, or working for the Nazis.
-- an IT Technician
Meanwhile, there's a study circulating saying that people don't and
won't purchase heavily restricted music online at higher prices for a
less useful item. This is apparently a revelation to the music industry.
-- Michael, Slashdot.org (2001-08-31)
I pledge allegance to the window icon of the United States of America.
And to the corporation for which it stands, one nation under Microsoft
indivisible thru FUD and litigation for all.
-- Larry(?)
How do you power-off this machine?
-- Linus Torvalds, when upgrading linux.cs.helsinki.fi,
and after using the machine for several months.
Any sufficiently advanced Operating System is indistinguishable from Linux.
-- Jim Dennis
What luck for the rulers that men don't think.
-- Adolf Hitler
All complex systems that work began as simple systems that worked.
-- unknown (2001-08-07)
The dead hand of Asimov's mass psychology wins every time.
-- unknown (2001-08-07)
"You can count on the Americans to do the right thing, once they've
exhausted every other possible course of action."
-- Winston Churchill
This message was encrypted with rot-26 cryptography. Attempting to
circumvent this encoding is illegal under the DMCA.
-- ajuda (2001-08-02)
I'm willing to bet that Mircrosoft will appeal this to the Supreme
Court, if only to slow down the process. Microsoft won the browser
with the tactics no being declared illegal and is looking to win instant
messanging, multimedia delivery and a few other items this way as well.
WinXP is the key to this, and it has to ship soon, and with all the
'features' in place. Microsoft is just playing the game to prevent the
gov. from stopping the release of XP. Once XP is out there, it can't
be taken back. If Mircrosoft is forced to play fairly only after XP is
released, it's more bad news for the rest of us.
-- Derkec (2001-08-02)
The four horsemen of the infocalypse ride again. Every time a
new restriction to our rights is planned they drag out: Porn, Terrorism,
Crackers, Drugs. This time, it has to be porn. The real target is people
sharing files, period. But rather than get into a discussion about what
(used to) constitute fair use they need a demon. If it plays on one of
the four fears above they have a good excuse for doing whatever they want.
It didn't work so well with encryption (even though they invoked all four).
Saying "It would hurt Sony's business model" isn't quite sexy enough.
So it has to be one of the Four. Look for more restrictions on file
sharing period sometime soon.
-- Walter Wart (2001-07-27)
It's an impressive feat to put the last nail in your own coffin while
you're on the inside!
-- warpath (2001-07-17, commenting on Napster's decision
to introduce its own .NAP music format)
You know what I never understood: Why did it become expected that
technical support people should be able to fix any software problem
through the phone? I can't call up Toyota and ask them to walk me
through replacing the starter on the car, especially if I don't know what
a wrench is. They'll tell me to bring it to the repair shop. I can't
demand that Maytag explain to me how to repair a washing machine through
the phone, even if it is under warranty!
-- Stan Seibert (2001-07-11)
"Here to discuss how the AOL merger will affect consumers is the CEO
of AOL."
-- Wolf Blitzer (CNN), 2001-01-12
"It is an elegant weapon from a more civilized time ..."
-- Obi-Wan Kenobi, referring to the slide-rule
calculator
Software of the living dead... This is why Microsoft hates GPL
software. The company goes bust and a month later there is a new release
of the competing software. Nothing, but customer disinterest has ever
killed a GPL project. And Microsoft _still_ can't beg, buy, borrow,
or steal the software. It is just too funny.
-- Jimmy the Geek (2001-07-05, discussing the Nautilus
1.0.4 release)
Probably illegal: The monopoly uses technical "dirty tricks", exclusionary licensing provisions, industry alliances or threats of retaliation that are clearly anticompetitive and have no conceivable or defensible rationale other than squashing a competitor.
The Mobile Internet Kit's EULA appears to fall into the latter
category. If so, it's yet another instance of a more general pattern of
anticompetitive, deceptive actions that has been undertaken by Microsoft--a
pattern that led a strongly pro-business appeals court to rule unanimously
that the company has systematically violated the Sherman Act.
-- Bryan Pfaffenberger (2001-07-03)
What greedy king were we (in the UK) troubling you all with in 1766? My knowlege of history isn't that good.
That would be George [III]. Actually, the "stamp tax" bit was a businessmen who tricked the working class into dying (as is always done) "for their country". Fortunately, when the actual structure of government was formed, it was all a Masonic plot, so we ended up with some pretty idealistic stuff. The die for the "Great Seal" of the United states was never fully cut because by then the government was taken over by Christians who were trying to stamp out the Masonic stuff.
The reason John Handcock signed his name so large on the Declaration of Independence was so George V would know he had a bad debt on his hands "without his spectacles". Handcock owed the king a bundle.
Another businessman fished the tea out of the harbor, and I understand
you can still buy a cup'o (at a goodly price). Much of this info is
courtesy of the Smithsonian Institute which published it in their magazine
just before the "Bicentinial" to the distress of good patriots everywhere.
-- Andrew Grygus (2001-07-02)
"And that no man might buy or sell, save he that had the mark, or the
name of the beast, or the number of his name."
-- Revelations 13:17, referring to Microsoft® Passport®
There once was a taylor who moved to the South and opened a store.
The Klu Klux Klan got wind of this and sent some children to yell nasty
names and curses outside his store. The taylor saw that these children
would drive away his business so he quickly dashed outside and said to the
children "I will give each of you a quarter to keep swearing at my store."
The children happily agreed, took the money, and continued swearing.
The next day they came back and the taylor said "oh, I'm afraid the
quaters were just for yesterday, today I will only give you a dime each."
The children were a little upset but they took the money and kept swearing.
The next day the taylor only offered them a nickle each, half the children
left but the other half were happy to swear at his store for a nickle.
The next day even more children gave up because the taylor would only pay
them a penny each and on the last day none of the children would swear
at his store because the taylor refused to pay them at all.
-- Classic Jewish Tale
Remember: behind every sleazy lawyer there's a sleazy client.
-- rgmoore
Clearly, the issue between Microsoft vs Linux isn't about one product
vs another anymore (which really is where the argument truly belongs, in a
more normal world) - it's about unbridled greed vs meaningful freedom and
social justice. This is a bigger battle than most people realize. This is
turning into a war over power - who will have it (Microsoft), and who won't
(you and me). Linux as a form of social protest. Who could have imagined.
-- Bakody (2001-06-21)
When the USA does it, it's progress. When Canada does it, it's just
another tax grab by socialists.
-- Anonymous Coward (2001-06-20)
... Until you've spent $140,000. For that money, a local company
called the Gene Donati Orchestras will send a string quartet to your home
and play on your patio once a week for more than a year. Which is why
audiophiles spend a lot of time defending their sanity.
-- David Segal, Washington Post Staff Writer
(2001-06-13)
if(strstr($HTTP_USER_AGENT, "MSIE 6.0")) {
echo "This page will not display properly in your browser; get a real one."
}
-- Skweetis (2001-06-12)
Anyone who lets someone else keep their data is nuts. Anyone who
lets someone who runs a free website keep their data deserves to lose it.
Anyone who cries when a free website is changed and they are not notified
is an idiot.
-- stoolpigeon (2001-06-12)
ASPs and Data Hostaging could be the .com boom-bust of 2001/2002.
-- Craig Bruce (2001-06-12)
Mary had a crypto key, she kept it in escrow, and everything that Mary
said, the Feds were sure to know.
-- unknown
Man will never be free until the last king is strangled with the
entrails of the last priest.
-- Diderot
"There is nothing more pathetic than a slave who thinks he is free."
Wrong. There is nothing more pathetic than a free person who thinks
he is a slave.
-- LS (2001-06-05)
Prime movers in keeping drugs illegal are ... the countries producing
illegal drugs, since the black market allows them to create a bindle of
powder for $0.25 and sell it to the end user for $100, but only if it's
kept illegal.
-- small_dick (2001-06-04)
Those pushing for more democracy should consider replacing medical
accreditation with a thumbs up/thumbs down vote at the local pub.
-- alexhmit01 (2001-06-04)
War! What is it good for?! Funding scientific research.
-- Mr. Hell
innovate, vb.: 1. To appropriate third-party
technology through purchase, immitation, or theft and to integrate
it into a de-facto, monopoly-position product. 2. To increase
in size or complexity but not in utility; to reduce compatibility or
interoperability. 3. To lock out competitors or to lock in users.
4. To charge more money; to increase prices or costs. 5. To
acquire profits from investments in other companies but not from direct
product or service sales. 6. To stifle or manipulate a free market;
to extend monopoly powers into new markets. 7. To evade liability
for wrong doings; to get off. 8. To purchase legislation,
legistators, legislatures, or chiefs of state. 9. To mediate all
transactions in a global economy; to embezzle; to co-opt power (coup
d'état). Cf. innovate, English usage (antonym).
-- Craig Bruce (2001-06-01) #707
When those insecure and maliciously potent Windows XP machines are
mated to high-bandwidth Internet connections, we are going to experience
an escalation of Internet terrorism the likes of which has never been
seen before.
-- Steve Gibson (2001-05-31)
Lie of the 70's = The check is in the mail
Lie of the 80's = Trickle down economics
Lie of the 90's = I have not had sex with that woman/man/computer/etc.
Lie of the 00's = Monopoly promotes innovation
-- ackthpt (2001-05-30)
Nobody wants to admit this. It is the Internet's dirty little secret
that when a company complains to an ISP about its shitty latency and packet
loss rates, it is NOT because Mr. PHB can't check his stock portfolio
(after all, he can do this over a modem with 20%+ packet loss and a ping
of 500 ms). It is because somebody in the IT staff just got fragged by
an LPB.
-- nyet (2001-05-24)
The win32 thing is a hundred times harder than that, because it's
a huge, poorly designed, inaccurately specified, buggy interface.
It's painful enough to even use that the vast majority of windows
programmers hide it behind some other tool. Recreating it perfectly,
without access to the source, is an exercise in futility, far harder than
making it in the first place.
-- Flying Headless Goku (2001-05-23)
Japanese culture is very different from ours, one of the main
differences being their insistence on thinking about things before acting.
They think long-term, give everybody a say, and make sure that everybody is
in agreement before acting. Here [in the US], we just cower to whomever
has the most legal representation and cave in. And our patent office,
as well as most branches of government, is no exception.
-- Bitterman (2001-05-15)
As for Office XP subscriptions, I don't think we've seen the last
of this. I just think MS realized they would have too hard a sell
with that. I think they'd much rather sell Office XP and put it on all
Windows desktops, and THEN go over to subscriptions if people want to
keep accessing their documents. Gotcha.
-- Kasreyn (2001-05-06)
Every truth has a context.
-- Ray(?)
Well, you see, in the beginning oh, about 15 years ago, there was
SGML and DTDs. But the powers that be decided that this was far too
complicated. So they decided that they would replace it with a much
simpler framework. This new system currently consists of XML, DTDs,
XML Schema, CSS, DOM, SAX, SOAP, UDDI, WDDS, WSDL, RDF, RSS, URIs, URLs,
URNs, XForms, XHTML, XLink, XML Signature, XPath, XPointer, XSL, XSLT,
JAXP, JAXM, TrAX and a few hundred other acronyms and abbreviations which
I shall omit for brevity. As you can clearly see, the old system was
just far too unwieldy and complex. I am glad that they have made things
so much simpler.
-- Anonymous Coward on Slashdot.org (2001-05-04)
XAS: XML Alphabet Soup.
-- Craig Bruce (2001-05-05)
This really is a pivotal moment, isn't it? MS can't buy open source,
can't co-opt open source, can't undersell open source. But it can
buy legistlators and legislation. That's what's coming. Take a look
at mundie's bio on MS's website - major-league contact with They In
Washington.
-- Paul Revere (2001-05-03)
When encryption is outlawed, ?o'AZ-,++o+i++##4AoA+-/-C++bI+/.+~
-- unknown
The Internet is not about technology. It's been around since the
sixties, and the Web could have been invented in the seventies. The Web
is about community; the technology only gives us an opportunity to meet,
and that's where the magic starts. Strict control over a portion of the
Internet immediately renders that portion useless.
-- iamklerck (2001-04-30)
Byers: We uncover the truth.
Morris: The truth? That's what's so great about you monkeys. Not only do you believe the horse pucky we create, you broadcast it as well. I mean look at this! [Headline reads: "Saddam testing mandroid army in Iraqi desert."] There is no Saddam Hussein. This guy's name is John Gillnitz, we found him doing dinner theatre in Tulsa. Did a mean "King and I." Plays good ethnics.
Langly: Are you trying to say that Saddam Hussein is a goverment plant?
Morris: I'm saying I invented the guy. We set him
up in '79. He rattles his saber whenever we need a good distraction.
Ah... if you boys only knew how many of your stories I dreamed up while
on the pot.
-- The X Files
You can kill a man but you can't kill what he stands for. Not unless
you first break his spirit. That's a beautiful thing to see.
-- The Cigarette Smoking Man (Cancer Man), The X Files
Aha! This is quite clearly, at least to me, a stab in the dark at
getting money. See, their current business model isn't working, and
they aren't getting any money. So they figure, "If I can't get money
legitimately, I'll sue people!" So they go around claiming that everyone
owes them money. This is the last gasp of a dying company, I think.
-- ywwg (2001-04-26)
There is interesting information in that article: according to IDC,
in 2000, 44% installed base of Windows was Win98, 33% Win95 (still quite
high, hmm?), 22% Win NT Workstation or Win 2000 Pro (they did not detail
it, I wonder how much was really Win2000 Pro) and 1% Win ME. It seems that
there is quite a window of opportunity (oops...) for Linux... By the end of
2000, 78% of MS desktop users had NOT upgraded to Win2000 yet... (or more,
since those 22% are a mix with Win NT WS) and with Win XP coming soon,
who would do it now?
-- Spectra (2001-04-25) [I would suspect W2K is ~2%]
Samba 2.2 also can act as an "authentication source" for Windows 2000
computers, meaning Windows 2000 machines can be fooled into thinking the
server is a Windows server. Writing this authentication feature was a
"nightmare" requiring months of work, Allison said. "The main problem
is getting something that works without crashing the (Windows) NT/2000
client."
-- Stephen Shankland on C|Net (2001-04-21)
ZDNET, although they parroted the standard Linux bashing lines, actually
said some good stuff in the context of using Linux as a desktop system.
2 years ago, Linux would never be a server replacement. 1 year ago,
we would never be a heavy duty server replacement. 6 months ago, we
were a great server, but would never be on the desktop. Now, we are an
"OK" desktop.
-- NotBillGates (2001-04-21)
It's the great urban legend of our time: Windows is easy to configure -
everything's pure plug and play (Guess it has something to do with the
fact that the computer comes configured when you buy it.). Anyone who
has ever tried to upgrade or repair a Windows box knows better!
-- George Mitchell (2001-04-21)
As for "integration" and "management features", Samba has the added
benefit that it's *nix and most of my customers don't know enough *nix
to go in and screw up the server itself. That's a BIG plus. No phone
calls saying "David, we're sorry, but Susie was fiddling around on the
server and now it won't boot". That alone is enough to blow NT/2000 out
of the water as far as I'm concerned.
-- davidd (2001-04-21)
Its as trendy today to rip on dot coms as it was 1.5 years ago to
write about Linux, of course I'm biased ;)
-- CmdrTaco of Slashdot (2001-04-17)
I'm sorry buddy, but that's just crap. If we canadians felt like
building some great nationilstic ventures, we would, cost doesn't even
venture into it. How many nations of 30 million people have G7 status eh?
Us and Australia that's who - and there are scads of countries with way
more people who can't claim that. We have definitely got the money to
burn on meaningless nationalism if we wanted. The reason we don't do it
is two-fold: firstly canadians just don't have any nationalist sentiments,
or very little. Hell most of us don't even know what it is we identify
with as a country. Secondly the business and political culture of our
country is so tight-assed and conservative that they refuse to invest in
anything canadian for fear that it will flop, despite the overwhelming
evidence that as such a small nation we have an insane overabundance of
intelligent, talented and creative people.
-- corvi42 (2001-04-16) [Well, Australia isn't a G7
country.]
The .NET thing has potential as a time sink. Implementing RPC via XML will be hideously inefficient. And interpreters are involved, which typically means a 10x performance loss.
Not that Java is much better. Swing seems to need upwards of 1GHz
just to display menus as fast as a 20MHz Mac of a decade ago.
-- Animats, on increasing PC sales (2001-04-15)
E-business, however, is not the same as what we call the "dot com"
model. The dot com model is content for advertising. E-business is a
more robust form of catalogue and phone business, which has survived for
years and years before computers could count to 257.
-- dasmegabyte (2001-04-12)
Kicking any bad habit weather it's heroin, or windows is hard but it
can be done and you'll have more freedom afterwards.
-- Malcontent
It would be a great tragedy were we to stop the wheels of progress
because of an incapacity to assist the victims of progress.
-- Alan Greenspan
I was very lucky to go to school at a time when excellent teachers
were the norm, not the exception.
-- Ben Stein
Those who cast the votes decide nothing. Those who count the votes
decide everything.
-- Joseph Stalin
Forgive me if you've heard me say this before, but Microsoft isn't in
the software business, and maybe not even in the money-making business.
They're in the stock market business. The cash flow is just a necessity
of keeping the stock bubble fully inflated, and the software is just a
way of generating that cash flow.
-- Bobby D. Bryant (2001-03-29)
X has problems, UNIX has problems, computers themselves have problems.
Nothing stops us from fixing those problems except the limits of our
own paradigms.
-- be-fan (2001-03-20)
People who bite the hand that feeds them usually lick the boot that
kicks them.
-- Eric Hoffer
Hundreds of dot-coms have turned into dot-gones.
-- Gareth Barnard (2001-03-16)
Then, in 2000, one company after another was thrown onto the
dot-compost heap. The revenue stream dried up and there was no money
for new hardware. So now, when you need a new web server, you go to
the boneyard. Every company has one. You pull out an old machine with a
200-MHz Pentium and 64 Mb of RAM. You load Linux and you're good to go.
That's one less Pentium sold and one less copy of Windows 2000.
-- Gareth Barnard (2001-03-16)
Whatever... so long as they go down in a flaming heap.
-- kwashiorkor, commenting on the RAMBUS patent trial
(2001-03-15)
Personally, I think a school's job is to teach not just the three
R's, but also participation as a citizen in our Republic. That may be
more important. For a school to teach freedom as a dry document while
crushing student dissent is a waste.
-- jamie (Slashdot) (2001-03-14)
The sooner we finish the initial implementation, the sooner we can
start fixing it.
-- Craig Bruce (2001-03-14)
My point is that industry types, whether they are applying nueral
networks to read handwriting or creating thinner flat panel displays,
solve the same complicated types of problems that the more 'scientific'
community solves. The scientific community discredits their work because
"Theoretically it can be done, so why bother doing it." It's as though
the companies that want to enhance their products by funding research
shouldn't fund the research that is most likely to enhance their products!
-- grammar nazi (2001-03-14)
No one should be able to patent something that could be designed by
a marketing department.
-- some co-worker of Badgerman
I hate microsoft........and I am an MCSE. Just watch the disinterest
from recruiters at job fairs when you hand them your resume and
announce that you have the MCSE. Soooo much time and money wasted on
an ever-expiring certification..... I am currently learning Oracle and
Unix instead.
-- Hindenburg
After much negotiating and haggling, with Spyglass still refusing to give away their baby for what was sure to be a paltry one-time licensing fee, MS came back with an offer they couldn't refuse. The MS team came back and said "Spyglass, we like you and we like your product and we are going to make you an unprecedented offer, something that no MS partner has never had. Instead of a one-time licensing fee, we will give you a PERCENTAGE of all revenue generated by the sales of any browser based on your source code." Spyglass's eyes glazed over at the thought of getting a permanent piece of MS's action. And so Spyglass's fate was sealed.
Microsoft has never charged anyone a dime for IE. And the dollar value
of Spyglass's percentage: $0.00. Forever. Browser market destroyed.
Corporate jewels in MS hands. End of Spyglass.
-- Mark S
The lesson of the DMCA is that purchased legislation tends to be
lop-sided.
-- Craig Bruce
Also, eventually the public backlash against the complete loss of
fair use provisions ("You have the right to fair use, but it's illegal
to exercise that right!") would end up dismantling parts of the DMCA.
As the Tobacco Industry has shown, eventually public outrage can overcome
the most powerful lobbies in the world.
-- Noer
But I'm rapidly losing interest in giving a single fucking dime to
publishers and recording companies which are trying to eradicate people's
fair use rights while paying their artists less than 35c on an $18 CD.
If their business model requires that kind of markup, they deserve to
die a revenue-hemorraghing death.
-- RandomPeon
If you want to tell the difference between a principle and a platitude,
invert a statement and see if the result sounds absurd. If no one could
possibly support the opposing sentiment, the original statement is merely
a platitude that adds no value to a discussion.
-- ZDNet
The article [on code being stolen for the GPS system] clearly says
"Source Code" not "access codes". All this means is the military
(and Exigent) will getting their first lesson in Systems Security 101:
Obscurity != Security.
-- coolgeek
MBA's: Can't live with 'em. Can't legally torture them to death.
-- Bonker(?)
Re-Elect Gore In 2004.
-- cje(?)
If the military decided they needed a much larger presence in space (for
missile defense for instance,) chances are a cheap launch vehicle would
be developed in a hurry. A few years later, the military technology would
trickle down to the civilian market and we would have cheap spaceliners.
This almost makes me want a good Cold War style arms race between the
U.S. and China, if it weren't for the risk of nuclear Armageddon.
-- meldroc
Microsoft's use of the word "innovation" should be read as
"appropriation".
-- Craig Bruce
Most legislation is passed by people who aren't even paying attention
to what they're doing.
-- Bonker
Remember, at Redmond "innovate" means "buy or steal, and then put our
brand name on it". With that definition, yes, the GPL *is* a threat to
"innovation".
-- Bobby D. Bryant
With GPL the only thing Microsoft gets for free is nightmares.
-- Jean Francois Martinez
Binaries may die but source code lives forever.
-- ESR(?)
So we can expect a huge rise in successful attacks. Managers will have
their "plausible deniability", intruders will be demonized and Microsoft
will count the money.
-- Trimtab
No, the Microsoft Firewall will be marketed towards pointy-headed
bosses, who will be blinded and wooed by the blinking lights and the shiny
Windows (TM) Interface (TM). The pointy-headed bosses are the ones who
legislate this stupidity on a corporate-wide basis, regardless of merit
or technical quality. THIS is Microsoft's target market. It has worked
for them for over a decade now...why change what works?
-- g
Many of these people will continue to use bad security inside their
walls because "Hey, we have a firewall, what do we need SSH for?"
-- Mike Rasmusson
It seems like "innovation" is a lame code word for "anything that makes
life more difficult for the customer while guaranteeing a butt-load of
cash for Microsoft."
-- David Wollmann
An org that treats its programmers as morons will soon have programmers
that are willing & able to act like morons only.
-- ksheff
RDRAM only looks good on paper and a few carefully constructed (ie,
outright lies) benchmarks. All the claims of Rambus are outright lies.
And you can quote me on this. They're thieves, cheats, and liars.
They produce no product and exist merely to patent technology invented
by other people. If there's a list of people most deserving of prison,
these guys and all their shareholders belong on it.
-- WNight
And it will be good for the whole tech industry for RAMBUS to fall in
a spectacular and final fashion. The RAMBUS business model (dishonestly
patent shady IP then sue everyone) needs to be demonstrated to be
a failure.
-- mikethegeek
FTC v. Dell, 1996. While Dell was a member of VESA, it failed to
disclose a patent relevant to the VESA Local Bus standard which it
participated in developing. When Dell tried to enforce the patent some
years later, the FTC stepped in, and Dell ended up signing a consent
decree preventing enforcement of that patent. One month later, Rambus
bowed out of JEDEC.
-- Anonymous Coward on Slashdot
Innovation is usually the result of the work of a few people rather
than the output of the million monkeys of the Internet.
-- dglo
Are prostitutes allowed to write off the depreciation of their capital
equipment?
-- Craig Bruce
Sorry, but until it's not all about money anymore (yeah, right)
either General Motors - in terms of revenues - or General Electric -
in terms of market capitalization - is the most powerful, influential
company in the United States. Microsoft is number 84 on the Fortune 500.
In deference to our international friends, Microsoft is only number 216 on
Fortune's Global 5000. Hell, Microsoft didn't even know what a lobbyist
was until the anti-trust case was filed.
-- markt4
Most serious software for "running the business" runs on high-speed
servers from Sun, IBM, HP, DG and others. The critical business software
is giant Oracle databases. And even there Oracle is not all that crucial
since a database is a database. The data could just as easily be put
onto a Sybase, Informix, DB/2 or other database system.
-- markt4
There are two kinds of researchers: those that have implemented
something and those that have not. The latter will tell you that there are
142 ways of doing things and that there isn't consensus on which is best.
The former will simply tell you that 141 of them don't work.
-- David Cheriton
The history of software shows that availability wins out over technical
quality every time.
-- Charles Hedrick
strcmp("ahead of its time", "failure") == 0
-- Craig Bruce
I apologize for the rambling nature of this post, it's just that I
have seen so many folks get sucked into the MCSE treadmill, and it's like
seeing someone you know get destroyed by a gambling addiction. We'll be
hearing more and more from these modern day versions of Willy Loman
("Death of a Salesman") as they sense the world of Microsoft eroded by
forces they can neither control nor understand. Let us not be too smug,
for their pain is real.
-- Cole Thompson, on Linux Today
If at first you don't secede, try, try again.
-- Win Ben Stein's Money (actually not referring to
Quebec)
This is not to deny that MS brown-nosers and cheerleaders still exist in
large numbers. But their claims are no longer being taken at face value.
-- Evan Leibovitch
No-one really believes that Microsoft is going to be selling its own
OS in ten years, do they?
-- Jimmy the Geek
Kids (and adults) WILL generally fill in the blanks in their knowledge
with the scariest possibilities. Often far scarier than reality could
possibly produce. (That's why conspiracy cults and doomsday cults are
as popular as they are. They claim to be able to fill those blanks in.)
-- jd [include Religion and I agree -csb]
If Java on the desktop was useful it would be a threat to MS.
Unfortunately Java on the desktop has been mostly hype (please note I
qualified that with mostly, YOUR spinning cube is amazing).
-- glrotate
I'm sure Pillsbury's lawyers know very well that the claim is absurd at
best and are relying on intimidation to do what the law won't. Personally,
I think lawyers who participate in that sort of intimidation should be
disciplined by the Bar or the courts. It's not much better than robbing
a bank w/ a toy gun.
-- sjames
IBM cannot "hijack" Linux. Once again, columnists confuse money with
important things like freedom and good software.
-- David F. Skoll
The more you tighten your grip, the more systems will slip through your
fingers.
-- Princess Leia, discussing Microsoft's Whistler licensing
mechanism
Higher prices coming at a time of shrinking sales? Sounds like
Micro$oft is not-so-quietly moving into endgame / exit strategy on its
software sales.
-- cr
Naw, this isn't your father's NASA. Today those guys would have
probably died while they were fscking around rebooting their NT boxes
on the ground at mission control to verify that it wasn't an anomaly
in their telemetry. I'm probably just dealing with the wrong people,
but these are definitely NOT the types that could improvise anything.
Even suggesting some non-COTS solution is like hitting them in the head
with a clue stick. They just stare at you like you're speaking Martian.
-- drsoran
Lets face it, no matter how good a chip is, most people just assume
that clock speed is what is important. The marketing people want higher
clock speeds, that's what they are going to get.
-- enterfornone, discussing the disappointing Intel
Pentium-4
Reboot, reinstall, upgrade.
-- The Microsoft Treadmill
*grin* If I'd known then that it would be my most famous accomplishment
in life, I might have worked on it another day or two and added some
more options.
-- Mike Muuss (1958-2000), author of "ping"
This is exactly what happens when the staff of a technology company
is 50% lawyers. I suspect that this is only the beginning of a era of
corporations who produce nothing, design nothing, contribute nothing,
but profit from continuous litigiousness, all because of stupid US law
and legal practice.
-- Alcoholist
"Where do I say that guys don't suck? Everyone sucks. Guys suck
less than chicks though, because we're simple. We want sex. Most chicks
don't know what they want."
-- chickssuck.shutdown.com
If he calls 40 times, and you talk to him the 41st, you've just told
him that the price for talking to you is 41 phone calls.
-- John Douglas
These two things are actually related. After all, the people that chase
down patents are not productive contributors to society's building of a
better world. They create nothing, but merely leech off the creativity
of others. They are the fine upstanding members of the legal profession,
for whom logic and commonsense can be freely disregarded when sophistry
and technicalities are judged to yield a better paycheck.
-- Morgaine
Microsoft does not control their own platform anymore. Their
installed base is spread across 5+ Win32 implementations, including
95/95OSR2/98/98SE/NT351/NT4/2000. Office *has to* run on every single one
of those, because many home and business customers don't upgrade their OS
much if ever. This plays right into Wine's hands, since Office cannot use
any new whizbang features on new MS OSes. They are being slowly strangled
to death by their very own market share - it's a beautiful thing, and it
goes along with ESR's arguments about DOJ being fun but unnecessary.
-- Ian Schmidt
"My bubble sort is too slow! I need an Athlon!"
-- Junks Jerzey
Patents are not about protecting the people who invent; rather, they
protect the people who can afford the process of filing a patent.
-- SigmoidCurve
The rushed, sometimes panicky entry of large corporations into a culture
which is at heart architecturally open and markedly individualistic seems
at times like a cultural civil war. Legal conflicts now seem to outstrip
technological experimentation, advances and breakthroughs, lawyers getting
as rich off the Net as they do in product liability or malpractice suits.
-- JonKatz, describing life on the internet
Step 1: Generate a bogus business-model patent, like this one.
Step 2: Sue everyone else who uses it.
"[Jumping into Windows 2000 is] like giving yourself a self-inflicted
gunshot wound."
-- Dustin Sauter, enterprise systems engineer at Wells
Fargo
The DMCA was created for things like this. You're not buying books,
you're buying licenses to read books. It's like a library where you pay.
And someone will come up with a way to break the woefully inadequate
protection system they have there so people can read the books when they
like, and they will be sued, even if they live in some other country.
And we will be better off because with rights and freedom, chaos would
immediately ensue.
-- icqqm
My Intro to EE professor told us a story about the preliminary
discussions at Sony concerning VCPs (video cassette players). Some VIP at
Sony asked "Why would someone want to see movies at home when they could
go out and see them?". One of the designers turned and said "Porn",
and that was that.
-- Mandomania
When Radio first came out, it was everybody talking to everybody else.
It was going to liberate everyone, and free the information for the tech
nerds. But we all know what happened, air filled with the meaningless
chatter of a few, franchise radio stations owned by Disney. I would like
it if that didn't happen to the Internet.
-- delmoi
We don't know how bad things are in North Korea, but here are some
pictures of hungry children. -- CNN
-- delmoi
We live in an age of apologies. Apologies, False or true, are expected
from the descendants of Empire builders, slave owners and persecutors
of heretics, and from men who, in our eyes, just got it all wrong.
So, with the age of 85 coming up shortly, I want to make an apology.
It appears I must apologze for being male, white, and European.
-- Sir Alec Guinness
"Gnutella can withstand a band of hungry lawyers. How many realtime
search technologies can claim that? Not Napster, that's for sure.
Just to emphasize how revolutionary this is: hungry lawyers are probably
more destructive than nuclear weapons."
-- Gnutella FAQ
"For a list of the ways in which technology has failed to improve our
quality of life, press 3."
-- unknown
The only people left who are surprised by the public's distrust of
the media, are media people themselves.
-- sansbury
Americans are like Canadians with twangy accents, too many guns,
and a big problem with crime.
-- Exhibit A (Discovery Channel program)
OOG KNOW NO WORTHWHILE GIRL COULD STAND OBNOXIOUS PSEUDO INTELLECTUALISM
OF MANY POSTERS HERE!!! SO MANY SLASHDOT PEOPLE KNOW-IT-ALLS, KARMA
WHORES, ELITISTS, ETC!!! IF YOU LIKE THIS IN REAL LIFE, NO WONDER PEOPLE
NO LIKE GEEKS!!!
-- OOG_THE_CAVEMAN, on Slashdot
PS: I am very tired of self righteous people who want to mold the
world in their own image. Women don't like technical fields, so what?
Men don't flock towards positions in elder care, nursing or child care
yet I don't see articles bemoaning this.
-- Carnage4Life
Corel's interest in Linux predates Wall Street's. Wall Street is always
the last one to the party, drinks the most, then has a huge hangover.
-- peter penguin
GNUTella: Because the client is the server.
-- unknown
Unlike Bell Labs or IBM, MS research is not famous for its Nobel prizes, but only for hiring some of the best brains in the world and turning them into guacamole dip.
The major reason why Microsoft never comes out with any real innovation is that Bill Gates vetoes any idea that is incompatible with the only program he ever worked on -- the original MS basic. As Windows grew bigger, he extended his veto to any idea that was incompatible with the Windows GUI. Then he extended it to protect MS Office.
As time goes on, Bill G. extends his veto umbrella to shelter an ever
larger number of current products. The result is a stifling atmosphere
that kills any possibility of true innovation.
-- John Sowa
Left. Left. Left stop. Stop! Right. Stop. Now
down. Stop. Click-click. ...
Click-click. ... Click-click-click-click-dammit! Up. Up-up-up.
Stooooopppp!!! Left. Stop. Click-click. ...
-- JJS, describing how voice recognition would integrate
with a GUI environment
Voice input and control is much over-hyped. But voice control for
Windows makes about as much sense as a command-line-only drawing program.
-- AJWM
Godwin's Law, prov. [Usenet] "As a Usenet discussion grows longer, the probability of a comparison involving Nazis or Hitler approaches one." There is a tradition in many groups that, once this occurs, that thread is over, and whoever mentioned the Nazis has automatically lost whatever argument was in progress. Godwin's Law thus practically guarantees the existence of an upper bound on thread length in those groups.
It might be the year 2000, but 1984 is getting closer and closer....
-- geekflavor (snowphoton@mindspring.comNOSPAM)
"We're called rebels because we're easily manipulated into doing
stupid things."
-- randomly pierced guy in Dilbert comic
Today's Agenda: Redesign core processes to enable enterprise integration
of knowledge resources and tools.
-- after Scott Adams
"Of course IP issues would kill JPEG2000."
-- Sir_Winston on Slashdot (looking forward to another
GIF fiasco)
"The end of the internet economic boom is ... offtopic and uninteresting."
-- CmdrTaco (Rob Malda), Slashdot.org
This is how copyright should work. Like patents it's intent is
to encourage creativity by rewarding the author with limited exclusivity
for a time, then improving society by making the creation free for all
to use and build upon. Copyright was once 20 years (like patents), then
50 years, then author's life plus 50 years, then author's life plus 80
years, and now dead congressman Sonny Bony sponsored the last extension to
author's life plus 100 years. A fscking century! You see no problem here?
And *just* *by* *coincidence* ****ALL**** of these extensions happened
just shortly before the earliest Mickey Mouse cartoons were about to have
their copyrights expire. Are Disney's interests == the public interests?
-- Cmdr Taco (note the space, not "CmdrTaco")
How were they bought off? Well, one of the most important bits for
re-election is the endorsement of the local paper and TV stations. Guess
who owns a large chain of newspapers and TV stations? Why, the Mouse of
course! You either support this bill Senator, or we endorse your opponent.
In the corporate world they call this "synergy".
-- K8Fan
63,000 bugs in the code, 63,000 bugs,
ya get 1 whacked with a service pack,
now there's 63,005 bugs in the code!!
-- unknown
I've been doing some work under Windows with threads, and I tried
to start by designing a generalized class-based thread model before
dropping in my first thread. It didn't work - I had no idea what I needed
or how to bring it about. So I dove in and wrote something more Cish.
Five threads later, I know what should go into a class - it's the code
that I keep cutting and ******* pasting. I now know how to encapsulate
the functionality I need, smoothly, because I know exactly what it needs
to do and a functional way to go about doing it.
-- shren
"The [stock] market is a chaotic system and no matter how many charts
and formulas the 'experts' produce, they still can't tell you what will
really happen tomorrow until after it happens. Then they offer ad hoc
explanations with an 'I told you so' tag. Just like Jean Dixon. Just
like weather forecasters. If these experts know so much how come they
are still working for a living? They should be richer than Bill Gates."
-- Jerry Kreps
"That's odd. The LA Times acts as though this is a bad thing.
I guess it never occured to them that copyright was intended to foster
the creation of of works that weren't likely to be created otherwise,
so that the works would universally accessible, not provide a means to
document your ownership for the reason of denying access. It would seem
the internet has made copyright an obsolete concept in almost any context.
I'd rather have someone deny me their knowledge than copyright it. I can
afford to wait five minutes for someone to come up with the same idea and
disseminate, that copyright would deny. Copyright denies your right to
exchange information without first asking if you want to pay the cost in
losing that right to create the trivia that qualifies for such protection.
My tax dollars pay for enforcing laws which allow denying me the right
to information that was often created via more tax dollars."
-- unknown
"How ironic that the patent system was designed to help industry move
forward and is now the biggest threat to forward progress there is."
-- Artie FM
"Lawsuits like this make me wish I wasn't an American."
-- Dr. Sp0ng (about a lawsuit against id Software for
a shooting)
"I wish that politics weren't so much about getting elected and more
about doing something important once in office."
-- Dr. Sp0ng
"We feel that we need to 'do something' about Columbine, however
in typical American style that 'action' is punative rather than
rehabilitative."
-- PsiPsiStar
"What I find interesting is that my English teacher last year hated
violent video games, thinking they corrupt kids. She also knew I loved
them and spent much time at them. Yet, she still preferred me as the
quiet genius type to the immature jocks, who wouldn't know Quake from
Shogo. She never seemed to notice the discrepancy between her preconcieved
notions and reality, but that just goes to show you."
-- Datafage
"When the line between fantasy and reality is blurred in the mind of
a child, you can often times look directly at that kid's parents and
point out very, very severe problems in how they handled the task of
raising their child. Dylan Klebold left his house every morning wearing a
black trenchcoat with a swastika armband on, leaving a sawed-off shotgun
ontop of the dresser in his bedroom. His parents did nothing about it,
unfortunately. And by the time they understood the gravity of their own
neglect of their child, a dozen or more kids lay dead in a school."
-- Bowie J. Poag
It's a lot easier to fake good management than to fake good code.
-- unknown
Oh come on -- you've got [foreign-exchange] traders destabilizing
a country's currency for quick and dirty profit; entire economies in
free-fall because some asshole doesn't like the colour of his Range Rover.
This is the real Nintendo war. Distance people from the realities of their
decisions enough times, they forget that real people are being affected.
-- Traders (Canadian TV show)
Given enough eyeballs, all bugs are shallow.
-- catchphrase for open-source software
Sometimes, the best applause lies in knowing you have offended a fool.
-- Anonymous
If it doesn't cause a traffic jam, most people won't care.
-- Dan Rather(?)
"Jackbooted government thugs will do anything now in the name of
'safety,' and the average person will support such actions, because the
average person is a coward. ... I think we need to get back to trying
to preserve our Liberty, instead of trying to deny our humanity."
-- Brian Knotts
The "poor little website owners" are often up for a fight anyway - they're angry, they're determined, they know they're in the right and they don't want to see justice taken for a ride. The most extreme example would be the McLibel defendents, who faced personal bankrupcy to defend themselves in court.
So don't threaten them - threaten someone upstream from them, like the ISP. The ISP doesn't care about the rights and wrongs of the issue - they're looking at the money. And the money says that you have very little to gain by standing by your customer and everything to lose - the best commercial proposition is simply to drop customers as soon as anyone who can spell "lawsuit" writes to you, regardless of whether they'd have a case, and regardless of who the Good Guys might be.
This simple inequality is probably a bigger risk to free speech online
than any CDA style legislation...
-- Paul Crowley
Brien's First Law
At some time in the life cycle of virtually every organization,
its ability to succeed in spite of itself runs out.
Klipstein's Second Law of General Engineering
Firmness of delivery dates in inversely proportional to the tightness
of the schedule.
Shropenhauer's Law of Entropy
If you put a spoonful of wine in a barrel full of sewage, you get sewage.
If you put a spoonful of sewage in a barrel full of wine, you get sewage.
Evan's and Bjorn's Law
No matter what goes wrong, there is always someone who knew it would.
Fox on Problematics
When a problem goes away, the people working to solve it do not.
It is an institution the business and political leadership of Quebec
has every reason to value highly. Political uncertainty has imposed
economic hardships on the average Quebecker. But for the elite, the
threat of separation, accompanied by unending demands for concessions
to avert it, has become a fabulous tool for getting and holding power.
Quebeckers instinctively understand that they have nothing to gain by
separating--or by abandoning the threat to separate.
-- Reed Scowen
NT is a desktop operating system trying to be a server; Linux is a
server trying to be a desktop OS.
-- Codifex Maximus
"I've decided that I want to be an Industry Pundit for a day. It looks
to be far too much fun in comparison to actual work."
-- Paul Ferris
"It might perhaps broaden your horizons to read a book that doesn't
march in lockstep with your personal dogmas of hatred."
-- scrytch, on a book about Bill Gates to the Slashdot
crowd
"XML opens the door to interoperable information. My dream: In a decade
or so, 'proprietary, noninteroperable information' sounds as silly as
'proprietary, noninteroperable network' does today."
-- Tim Bray (one of the co-authors of XML)
"The big computer industry battle of the future will be waged between
Linux and Windows NT."
-- (*The*) Rob Pike, researcher at Lucent Technologies
Inc.'s Bell Labs unit, 1999-03-18
Youth haven't got expectations about how things "ought" to work, so
they're very easy to exploit. It's not hard to imagine the Spice Girls
adding a line or two about how much they love Coke or Pepsi.
-- pjones at slashdot.com, talking about new models
for the music industry in the MP3 Age
"They are just six guys, six software workers out of thousands in the
Triangle. But what they do in this sparse, two-room office in a musty
building a few miles from corporate headquarters could affect how the
rest of us work and live in the 21st century."
-- Joel B. Obermayer, describing the developers at Red
Hat Software
Children - the universal scapegoats for any political agenda.
Yes, I am a criminal. My crime is that of curiosity. My crime is that of judging people by what they say and think, not what they look like.
My crime is that of outsmarting you, something that you will never forgive me for. I am a hacker, and this is my manifesto. You may stop this individual, but you can't stop us all... after all, we're all alike.
-- The Mentor, "The Conscience of a Hacker"
[a note to the government agents currently viewing this web page, accidentally I am sure: I am not a hacker, but I think that the above quotation is thought-provoking.]
The big companies have no future. By and large, there are no more
advantages to big business. There are only disadvantages.
-- Peter Drucker, "The Relentless Contrarian", Wired magazine
interview
They're worried about becoming obsolete. They [the music industry
association] position themselves as middlemen, but -- guess what --
the Internet gets rid of middlemen.
-- Robert Schroeder, chairman of Diamond Multimedia
(Oct. 1998)
"So... I'm good enough to pay INTO all this shit. Good enough to pay for
other people to go to the doctor or dentist. Oh, that's fair. I worked at
a convenience store in high school. I watched families of 6 come in and
give each kid one food stamp. Each one of the kids would buy one piece of
penny candy. Each would get back 99 cents in cash. Then their parents
would come in 2 minutes later and buy 2 pack of cigarettes. All with
change. Good to know government dollars are being spent on better things
than my teeth, huh?"
-- Michelle, complaining about dental coverage
Politics is a pendulum whose swings between anarchy and tyranny are
fueled by perpetually rejuvenated illusions.
-- Albert Einstein
1935 will go down in History! For the first time, a civilized nation
has full gun registration! Our streets will be safer, our police more
efficient and the world will follow our lead to the future!
-- Adolf Hitler